** THE "SPYING AT THE WALL" DICTIONARY **
                      * WORLDWIDE DISTRIBUTION *
                             Last Update:
        $Id: spying.txt,v 1.15 1997/08/02 14:54:23 Barney Exp $
  This document (The Spying at the Wall Dictionary) is in the public
           domain, to be freely used, shared, and modified.
                      Send your own contribution
               or suggestions/corrections/comments to:
  			yohanb@134.29.8.241
               ** "Spying at the wall" Contributions **
                          ** HALL OF FAME **
GonTech Research, HardComp Research  Inc., The First National Software
Bank of  Gleyson, Luidgi Trovattore  Salvattore Ordinari Puglia Safadi
Schiaffino,   Artie-in-the-box, WeirdDreams  Software,  Soraggi, MagiX
Solutions  -  V.Falcone,  Ptialina Society  Corporation,  Alex  Zepka,
Joao Dovicchi,  Marco Antonio   Assfalk  de Oliveira,   Jason  Mendez,
Marcio  Alesandro Rocha, Chris  Baird, David  Zanetti,  Maria  Rosario
e Rogel, Dave  Byter,   Marcia  Dalla  Vechia,  Andrew Bromage,   Lesa
Cafferty, Sander  Goudswaard,   Matthias  Melcher,   Trond   Pedersen,
Spitzenberg,    Alexandre  Oliva,   Nicolas  Vallee,   Jessica   Roop,
Ricardo "Caco" dos  Santos,  Jerome Chik, Michel   Eftimakis, Charlene
Mirabella & Robert Boot, Evelyne Pichler,  Renato Mitsuo Wada, Lennert
Stock, Diogenes  Pacheco  de  Melo, Matias  Schweizer, Roland   Hangg,
Josemar Furegatti,  Ron   Lederer, Rodolfo Jose Leite   Netto, Luciana
Moutella Pimenta,  Osvaldo Fernandez   Junior, Luiz  Azevedo,  Emerson
R. Zamprogno,  jgs, Marcelo Malheiros, PooSung  Park, Allen Mullen and
everyone who has contributed to this dictionary.
======================================================================
[PEACEFUL ANIMALS -New]
                                        
                             ,%%%%%%%%,
                            %%/\%%%%/\%%
                     _,._  %%%\C "" J/%%%,
                 __.'   _) %%%/ o  o \%%%%       .%
                <_,)'.-"a\ %%%|  _    %%%%     .%%`
                  /' (    \'%%(__Y__)%%%%'     %%`
      _.-----..,-'   (`"--^ '%%%\-/`%%%%;       \\
     //              |        '%%%%%%%'  \       ))
    (|   `;      ,   |         |          '.    //
      \   ;.----/  ,/          | |  /       \  //
       ) // /   | |\ \         | | (         \//
       \ \\`\   | |/ /       __| | _\         /
        \ \\ \  | |\/       (((((((___________)
         `" `"  `"`  
   -----------------------------------------------
         ,. ,.  ,.,
        / // /  | |/\       (((((((~~~~~~~~~~~)
       / //,/   | |\ \       ~~| | ~/         \
       ) \\ \   | |/ /         | | (         /\\
      /   :'----\  `\          | |  \       /  \\
    (|   ,:      `   |         |          .'    \\
     \\              |        .%%%%%%%.  /       ))
      ~'-----''`-.   (,.--v .%%%/-\,%%%%:       //
                  \. (    /.%%(~~A~~)%%%%.     %%,
                <~`).'-.a/ %%%|  ~    %%%%     '%%,
                 ~~'.   ~) %%%\ o  o /%%%%       '%
                     ~`'~  %%%/C .. 7\%%%`
                            %%\/%%%%\/%%
                             `%%%%%%%%` 
                          Lion and the Lamb spying at the mirror wall
                                     __,
                                    /; \
                                    |;  '\
                                    |;' \^\
   _________________________________|: ^,/\________________________
                                    ')   /\/
                                     \,_ \/|
                                       \ (\_\
                                        ) /\_\
                                  _____/_/_/_/_
                                 ( ,___, _/ /_ )
                     --""-      """  / /_/_/ '""
                   /_o - -          / (_(_(_
                  (_ |   >)        (   \_\_\\
      _____      (___|  _='         \'  \_\_\\
     /     `----/      |            _\__\_\_\\\_              ,
  __/                \ |\          (  _, \_\_\\ )            /'
    |_    ,-      _   \, \_____     \_ \-,,\_\_\'        __,'_'
     '|  _/__      \   \_____)))     _) \ ',\\_'\_    __/.__,'
     /_____)))-----")______)))    ,///---'  '-,-\_\__/. __,'
                                             '-./_._.--'
                             ~~        ~~~ ~           
                               Spying Lion and Aligator spying at the wall
                    __
                   /..\  
            ___    \_c==< (.)_(.).----.
       ,   /\_/\   /\/     \6 6/       `.            
       |\_/-/ \-\_/\/      =\ /=         ;~~~~~~~~~~~  
_______\/_\/___\/_\/_________O_`mm-----mm'_______________
     
                             Snake and mouse spying at the wall
    _ ___
    \.\'.\         '\ \__O__/ /`    /_/_      .'''.  
     \'\'.\          `--(_)--'   =O(_)))) ...'     `.       
    __\.\:/_//      .---/ \---.     \_\              `.    .'''   
  -{{{{{(__(")     / /'(>I<)`\ \                       `..'
   `~~~~ >>>^      ` \  `-'  / '   
                      \     /
_________________________________________________________
                         Bees and Spider spying at the wall
                    __
                   /..\  
            ___    \_c==< 
       ,   /\_/\   /\/     o
       |\_/-/ \-\_/\/     -|- 
_______\/_\/___\/_\/______/_\_____
                     Snake and child spying at the wall
     
         __  (\_ 
        (_ \ ( '>      
          ) \/_)=   (\/)
 _________(_(_ )____(/\)__________________________________
                         Squirrel and butterfly spying at the wall
       
        ( )_( )      
         \. ./      /\-----/\  \\      
       _  =.=  _   (   @ @   ) // 
-------m---"---m---o0o-=@=-o0o----
                        Another mouse and a cat spying at the wall.
         .      *       o       .       * 
   o                |
             .     -O-    
  .                 |        *      .     -0-
         *  o     .    '       *      .        o
                .         .  o     |      *
     *             *              -O-          .
           .             *         |     ,
                  .      __|__    
          .---.   --o--o--(_)--o--o--
    =   _/__~0_\_     .               o       ' 
   = = (_________)             .            
                   .     *                  *   .
         *               - ) -       *      
   .             .               .            .
                __|__
    .    --o--o--(_)--o--o--  *      .     *
 ________*____________*______________________________________
                                  Planes and UFO spying at the wall
=========================================================================
[THE VERY FIRST DAYS]
   ___m_oo_m___         Spying at the wall.
   ___m_OO_m___         REALLY spying at the wall.
        `'
   ___m_oo_m___         Spying (terrified) at the wall.
        \/
   ___m_oo_m___         Spying (mistrustful) at the wall.
        ~~
   ___m_oo_m___         Spying (surprised) at the wall.
        ""
   ___m_OO_m___         Spying (scared) at the wall.
   ___m_+o+_m___        Clown spying at the wall.
   ^^m^^oo^^m^^^        Spying at the wall with nails.
        ~^
   ___m_-o_m___         Spying (tired) at the wall.
======================================================================
[ANIMALS]
      _     _
       \   /
   ___m_O_O_m___        Mosquito spying at the wall.
         |
         *
        O O
   ___m_|V|_m___        Bird spying at the wall.
         v
        __
        OO
       /||\
   ___m____m___         Owl spying at the wall.
             /
          OO/
         / /  **
        / /\
       / /
   ___/ /_____          Dragon spying at the wall.
        .
   -----------          Ant spying at the wall.
       O..O
   ---,--"--,-          Mouse spying at the wall.
        |\_/|
        |o o|
   --,---,^,---,--      Bat spying at the wall.
         / \
        /VVV\
       /V   V\
       |^^^^^|
   ___/_______\___      Jaws spying at the wall.
       . .
                    '.-:-.`  
                    '  :  `
                 .-----:    A whale spying at the wall.
               .'       `.
         ,    /       (o) \            
         \`._/          ,__)
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
   __mmmm_oo_mmmm__     Octopus spying at the wall.
   __\/_oo_\/__         Crab spying at the wall.
          ____
       /\   ..\/\
   ---()-`----'-()---   Yet another crab spying at the wall.
        (   )
   __w__(O O)__w__      Cow spying at the wall.
          U
   ____V@_____          Snail spying at the wall.
      (\/)
   ___(/\)____          Butterfly spying at the wall.
         __   \/
        (_ \ ( '>               
 _________(_(_ )______________________________________
                         Chick spying at the wall
   __m_(-O-)_m__        Koala spying at the wall.
       v   v
   __m_.(")._m__        Pig spying at the wall.
   __m_.(%)._m__        Yet another pig spying at the wall.
       |  o|
       |O  |
   ____|___|____        Giraffe spying at the wall.
           V
    v  ^
   _____________        Far gulls spying at the wall.
          _____
         / __<">
         | |
    _____| |_____       Elephant spying at the wall.
    ______,________     Yet another ant spying at the wall.
    _____,P________     Ant with banner spying.
    ___,,,,,,,,,,,,,,,,,,___   Ants marching and spying at the wall.
    ___,,,,,,,,,,,,,,,,,P,___  Ant Platoon marching and spying at the wall.
         Y Y
   __w__(o o)__w__      Hart spying at the wall.
          y
            __
           /..\__
          /      \
      _   \ `____/  _
   __/ \___|__|____/ \_____     Dinosaur spying at the wall.
     \_/           \_/
            \/__
           /    \
          /^     \
         /  __/\  \_
        |  /    \   \
         \/     | _| \
   ____________/_____|______    Dino spying at the wall.
           ___
          C ..\__
      _  |     00\    _
   __/ \_|_______/___/ \____    Hyppopotamus spying at the wall.
     \_/             \_/
               ___
        ___   / ..\__
       /   \  \/     V
   ___/_____\_|______/_______   Dromedaries spying at the wall.
                 ___
       ___  __  / ..\__
      /   \/  \ \/     V
   __/_____\___\|______/_____   Camel spying at the wall.
                 ___
           _____/)_)\______
   _______(,),),)/_\,),),),)_______  Earthworm spying at the wall.
           //
         _//
        .. ~~-_
   ___m<___m___~.___            Rabbit spying at the wall...
   _|__|__|__|__|__|
   |__|__|__|__|__|_
           //
         _//
        oo ~~-_
   ___m<___m___~.___            And the same rabbit after
   _|__|__|__|__|__|            finding Babs Bunny sunbathing nude...
   |__|__|__|__|__|_            (Babs Bunny of "Tiny Toon Adventures" fame)
               .---. 
              /   6_6       _       .-.
              \_  (__\     ("\     /.-.\  The Early Bird Catches
              //   \\       `\\   //   \\      the Worm! While
             ((     ))        \`-`/     \'-')spying on the wall.
  ============""===""=========="""======="""===
                |||
                 | 
                                     __,
                                    /; \
                                    |;  '\
                                    |;' \^\
  __________________________________|: ^, /\_______________
                                    ')   /\/
                                     \,_ \/|
                                       \ (\_\
                                        ) /\_\
                                  _____/_/_/_/_
                                 ( ,___, _/ /_ )
                     --""-      """  / /_/_/ '""
                   /_o - -          / (_(_(_
                  (_ |   >)        (   \_\_\\
      _____      (___|  _='         \'  \_\_\\
     /     `----/      |            _\__\_\_\\\_              ,
  __/                \ |\          (  _, \_\_\\ )            /'
    |_    ,-      _   \, \_____     \_ \-,,\_\_\'        __,'_'
     '|  _/__      \   \_____)))     _) \ ',\\_'\_    __/.__,'
     /_____)))-----")______)))    ,///---'  '-,-\_\__/. __,'
                                             '-./_._.--'
                             ~~        ~~~ ~           
                               Lion and Aligator spying at the wall  
                               (seen from behind)
                             ,%%%%%%%%,
                            %%/\%%%%/\%%
                     _,._  %%%\C "" J/%%%,
                 __.'   _) %%%/ o  o \%%%%       .%
                <_,)'.-"a\ %%%|  _    %%%%     .%%`
                  /' (    \'%%(__Y__)%%%%'     %%`
      _.-----..,-'   (`"--^ '%%%\-/`%%%%;       \\
     //              |        '%%%%%%%'  \       ))
    (|   `;      ,   |         |          '.    //
      \   ;.----/  ,/          | |  /       \  //
       ) // /   | |\ \         | | (         \//
       \ \\`\   | |/ /       __| | _\         /
        \ \\ \  | |\/       (((((((___________)
         `" `"  `"`  
   -----------------------------------------------
                                Lion and the Lamb spying at the wall
   (_\_|___|_/_)
       (o o)
        \ /
   __m___O___m___               Moose spying at the Wall.
        ( )_( )
         \. ./
   ____m__=.=__m___             Yet another mouse spying at the wall.
           "
               (o)(o)
              /     \
             /       |
            /   \  * |
           /    /\__/
          /    /
   ______/____/________         Yet another dino spying at the wall.
          (__)
          (oo)
   _____m__\/__m______          Cow spying at the wall.
         .---.        .-----------
        /     \  __  /    ------
       / /     \(oo)/    -----
      //////   ' \/ `   ---
     //// / // :    : ---
    // /   /  /`    '--
   //          //..\\
   -----------UU----UU-----     Eagle spying at the wall.
              '//||\\`
                ''``
              |
              |
              |
              |
              |
          /\  |  /\
         //\\. .//\\
         //\\ . //\\
         /  \( )/  \
   _____________________        Spider spying at the wall.
            |\
   _________|_\____________     Shark spying at the wall.
            -----
        /\-----/\  \\
       (   @ @   ) //
   ----o0o-=@=-o0o----          A Cat spying at the wall.
                    |_|
                    /_)
          _________//
   _______;;;;;;;;;;___________ Centipede spying at the wall.
       A/~~\A
      ((O  O))___
        \  /     ~~~
        (--)\
   -------------------          Cow spying at the wall.
       |\   |\
       \ \/~~\\
       ~{{@  @})
      ~  [    ]
   ~~~    ]  ]
         /(__)
   -------------------          Horse spying at the wall.
    |\   |\
     \ \  \ \
     \  \ \  \
      \  \/~~\\
       ~{{@  @})
      ~  [    ]
   ~~~    ]  ]
         /(__)
   -------------------          Jackass spying at the wall.
	       ,_                ,
	      /^\\              //\
	     |   \\            //  \
	     |    ||    ,==.  //   |
	      \   ||.=~////"=,||   /
	      /(\ /////////\\\\\  /)
	     (/(((///`~\\\\\)))\\///\
	    (//)))/_.-"")))\\((//((())
	    (((((((_.-"///"")).`')\\(\\
	    )))())'   (((   (   './//)))
	  (////~/       ))       (((/(/
	  /)///`        (         ))\((
	 `//(/_ '._             _.' _\\\
	 ((((/^\   '.         .'   /^\)))
	 (\)\\__\    '       '    /__/((
	   )))\       '     '       /)))
	  )//)/|       '   '       |(((
	 //))))/\      :   :      / ))
	 (((((\\|      :   :      | (
	  \\)\\\|      :   :      |
	   )))))|   _.--'''--._   |
===========/(/// \.'   _____   './======================================
	   (///( /  .-':   :'-.  \ Yet another horse spying at the wall
	    )))  \.'  .     .  './
	   ((     |  .       .  |
	    )     |/  '.   .'  \|
	          //(         )\\
        	  \\/         \//
	           `\   '''   /`
	             '.__.__.'
        	       `"""`
                                     __,
                                    /; \
                                    |;  '\
                                    |;' \^\
  _________________________________ : ^, /\ ___________________________
  ___[____]____[______]_____[_____] ')   /\/ ___[____]____[______]_____
  [____]____[______]_____[_____]____ \,_ \/| [____]____[______]_____[__
  ___[____]____[______]_____[_____]__  \ (\_\ __[____]____[______]_____
  [____]____[______]_____[_____]____[__ ) /\_\ ___]____[______]_____[__
  ___[____]____[______]_____[___  _____/_/_/_/_ ____]____[______]_____[
  [____]____[______]_____[____]_ ( ,___, _/ /_ ) ____]____[______]_____
  ___[____]____[___ __""__ __ __"""  / /_/_/ '"" _]____[____]____[___[_
  [____]____[_____ /_o - - ____]___ / (_(_(_  ___]____[______]____[____
  ___[____]____[_ (_ |   >)_[_____ (   \_\_\\  _____]_____[____]____[__
  [__ _____ [___ (___|  _=' ___]___ \'  \_\_\\  _]____[______[____]____
  __ /     `----/      |    ____[__ _\__\_\_\\\_ ___]_____[__ ,_]____[_
  __/                \ |\   [______(  _, \_\_\\ ) ____]____[ /' ____]__
    |_    ,-      _   \, \_____ [___\_ \-,,\_\_\' [____] __,'_' __[____
  [__'|  _/__      \   \_____))) __  _) \ ',\\_'\_ __]__/.__,' _[____]_
  __ /_____)))-----_)______)))  ] ,///---'  '-,-\_\__/. __,'  [____]___
                                             '-./_._.--'   [____]____[_
                             ~~        ~~~ ~           
                               Lion and Aligator spying at another wall  
   |\__/|  ____/|  _   /|   /\_/\    /\_/\    :\___/:   /\_-_/\
   \ O.O|  \ o.o|  \'o.O'  = o o =  ( o o )   \ O O /  (  0 0  )
   ---------------------------------------------------------------
                                Seven cats spying at the wall.
       @..@
      (----)
     ( >__< )
     ^^ ~~ ^^
   --------------------------   Toad sitting on the wall.
             |\ /|
             \ Y/
              |oo\
             / \ .)
   -------W----------W--------  Kangaroo spying at the wall.
   ______2_2222_________        Ducks spying at the wall.
           __
          (_ \
           / / ___
          / (_/ _ \__
   _______\____/_\___)____      Snake spying at the wall.
             ___
            / _ \
   ___OOO__|_/_\_|__OOO__       Sea lion spying at the wall.
     \
      \ /\
      ( )
   __(_o_)__                    Babs Bunny spying at the wall.
             __
           _U o\--
          /    ___/
         /    /
        /    /\\  ___
     \_/    /-\\-U o\__
       |   /   __  ____/
       |  /|  /  ||
   ____| |_| |___||____         Having fun and spying at the wall.
        o..o
   _______'____________         Monkey spying at the wall.
       "    "
   /--\___/--\     _____
   \/\ O o /\/ ___/ Bark\
     (  o  )      \ Bark/
   -----U-------------------
      " A runaway dawg who spots his master and by an accident
        barks loud and clear so that the master spots his dog-
        spying at the wall."
        ._,=~~``~~=,_.
     .=`  ~-.    .-~  `-.
   /`  /    {    }    \  `\
  |    |   _ \  / _   |    |
  |    /  /@) )( (@\  \    /
  \   |;     /  \     ;|  /
   \  | ;   / __ \   ; \ /
    `"`/`\ ; (..) ; /`\ `
     /`   \{  /\  }/   `\
---------------------------------------
St. Bernard puppy spying at the wall
       _.="""=._
     /`  \   /  `\
    /  / _} {_ \  \
   /  ; /o) (o\ ;  \
   \  |  / _ \  |  /
    \_/\| (_) |/\_/
      /`\_/=\_/`\
    /`    `"`    `\
   {               }
----------------------------------------
'Like father like son' spying at the wall
                  ...___..../\_
                 /            _\      ,''',
                /       _..., `\      ,   ,
              /        |     \__\     .   .
            /    \  \ /                ...
           (      ) | |                 =
   ________|   _/_  | |                 =
 <__________\______)\__)             (  =  )
 ---------------------------------------------------
  'Circus dog' spying at the wall. 
                      .
                     / V\
                   / `  /
                  <<   |
                  /    |
                /      |
              /        |
            /    \  \ /
           (      ) | |
   ________|   _/_  | |
 <__________\______)\__)
-----------------------------------
'Free dog' spying at the wall.
  
             \^o^o/
           ,^ ( ..)
   ----oOOo--| \   \--oOOo----
       ````   \ `^--^ ''''
               \ \ \
                ^--^
         .oo0O   O0oo.
         (   )   (   )
   -------\ (-----) /---------  Aligator spying at the wall.
           \_)___(_/
       ^\    |___|
       ` `^^^__ /
        `------'
                                           __     __
                                          /  \'''/  \
                                         /   (O O)   \
    +-------------------------------------oOO-( )-OOo----------------+
    |                                         ( )                    |
    |                                          \\                    |
    |                                           ~                    |
                                Elephant spying on the wall.
     _--_                                     _--_
   /#()# #\         0             0         /# #()#\
   |()##  \#\_       \           /       _/#/  ##()|
   |#()##-=###\_      \         /      _/###=-##()#|
    \#()#-=##  #\_     \       /     _/#  ##=-#()#/
     |#()#--==### \_    \     /    _/ ###==--#()#|
     |#()##--=#    #\_   \!!!/   _/#    #=--##()#|
      \#()##---===####\   O|O   /####===---##()#/
       |#()#____==#####\ / Y \ /#####==____#()#|
        \###______######|\/#\/|######______###/
           ()#O#/      ##\_#_/##      \#O#()
          ()#O#(__-===###/ _ \###===-__)#O#()
         ()#O#(   #  ###_(_|_)_###  #   )#O#()
         ()#O(---#__###/ (_|_) \###__#---)O#()
         ()#O#( / / ##/  (_|_)  \## \ \ )#O#()
         ()##O#\_/  #/   (_|_)   \#  \_/#O##()
          \)##OO#\ -)    (_|_)    (- /#OO##(/
           )//##OOO*|    / | \    |*OOO##\\(
           |/_####_/    ( /X\ )    \_####_\|
   ______ /X/_\__/_______\___/_______\__/_\X\_________
         (#/                               \#)
                                Butterfly spying at the wall.
         V7~~7V
          {oo}
          /  \
   _ooOO_(=()=)_OOoo_____       Dog spying at the wall.
    ''''  ~~U~  ''''
         )\ (  ) /(     sS* s S
         )-(0^^0)-(   S*S*sS*s
         )/ \\// \(  s*Ss*s*S
            (oo) s*Ss*s*SS*
   _____oOo__~~__oOo_____       Dragon spying at the wall.
              ^.__
           \__||
   ________((__\\________       Chihuahua dog spying at the wall.
         |\__/,|   (`\
       _.|o o  |_   ) )
   ---(((---(((----------       Cat spying at the wall.
         \\\\\\\\\
   ____ >|||||||||#> ___        Dead fish spying at the wall.
         /////////              (It was eaten by the cat...)
        >-\  \\\\ >=\
           | ////    |
   ________<*LLLLL>=-/______    Scorpion spying at the wall.
           | \\\\
        >-/  ////
          o o
        _< - >_
   ----------------    Frog spying at the wall.
        _<^*^>_
   -----------------   Dead Frog spying at the wall.
                   ,--,__
             _ ___/ /\|
         ,;~( )__, )  ~
        //  //   '==;
       '   \     | ^
   _________^____^_______  Unicorn spying at the wall.
       _____________
      / _   _   _   \        |||||
     / /_\ /_\ /_\   \------( . . )
   _/_________________\________O_____
                       Turtle doing nothing and spying at the wall.
=================================================================
[FAIRY TALES]
   __m___o_o_____m__    Rapunzel spying at the wall.
       ()   ()
       ()   ()
       ()   ()
       ()   ()
       ()   ()
       X     X
   ___m__@^@__m___      Rapunzel with glasses spying at the wall.
        () ()
        () ()
        () ()
        () ()
        () ()
        X   X
             *_
     ^       | ~~\
     |       |  ./
     |  (*)  |~~
     | _<">_ |
    o+o \ / \0
     0'\ ^ /\/
       /   \ |
      /__^__\|
       || || |
       || || |
   ____d|_|b_T_______   Sir Lancelot spying at the wall.
                .-" .-. "-.
              _/ '=(0.0)=' \_
            /`   .='|m|'=.   `\
            \________________ /
        .--.__///`'-,__~\\\\~`
       / /6|__\// a (__)-\\\\
       \ \/--`((   ._\   ,)))
       /  \\  ))\  -==-  (O)(
      /    )\((((\   .  /)))))
     /  _.' /  __(`~~~~`)__
    //"\\,-'-"`   `~~~~\\~~`"-.
   //  /`"              `      `\
=====================================
                                         Pirate spying at the wall
   ____
   |__||
   __|_/
   _|_|
   |__|
   __||
   _|_L________m__o_o__m_______________  Spying at the castle wall.
   |__|__|__|__|__|__|__|__|__|__|__|
   __|__|__|__|/ |  |  |\_|__|__|__|
   _|__|__|__||  |  |  | |__|__|__|__|
   |__|__|__|_|__|__|__|_|_|__|__|__|
_______________________________________
   ____
   |__||
   __|_/
   _|_|
   |__|
   __||           /\
   _|_L_________m/..\m_________________  Merlin spying at the castle wall.
   |__|__|__|__|__|__|__|__|__|__|__|
   __|__|__|__|/ |  |  |\_|__|__|__|
   _|__|__|__||  |  |  | |__|__|__|__|
   |__|__|__|_|__|__|__|_|_|__|__|__|
_______________________________________
   ____
   |__||
   __|_/
   _|_|
   |__|
   __||           /\
   _|_L_________m/..\m________________   Merlin spying at the castle wall
   |__|__|__|__|__|__|__|__|__|__|__|    and  casting a spell to open the
   __|__|__|__|/        \_|__|__|__|     gates.
   _|__|__|__||          |__|__|__|__|
   |__|__|__|_|__________|_|__|__|__|
             /            \
   ________ /              \___________
           /________________\
======================================================================
[THE SIMPSONS]
             __&__
            /     \
           |       |
           |  (o)(o)
           C   .---_)
            | |.___|
            |  \__/
            /_____\
           /_____/ \
          /         \
   --------------------------     Homer Simpson spying at the wall.
                    (####)
                  (#######)
                (#########)
               (#########)
              (#########)
             (#########)
            (#########)
           (#########)
          (#########)
           (o)(o)(##)
         ,_C     (##)
        /____,   (##)
          \     (#)
           |    |
           OOOOOO
          /      \
   --------------------------     Marge Simpson spying at the wall.
         /\ /\  /\
         | V  \/  \---.
          \_        /
           (o)(o)  <__.
          _C         /
        /____,   )  \
          \     /----'
            ooooo
           /     \
   --------------------------     Lisa Simpson spying at the wall.
              /\
        .----/  \----.
         \          /
       .--\ (o)(o) /__.
        \     ()     /
        >   (C_)   <
       /___\____/___\
           /|    |\
          /        \
   --------------------------     Maggie Simpson spying at the wall.
               ___  ______
             .'/,-Y"      "~-.
             1.Y              ^.
             /\                _\_
            i             ___/"   "\
            |           /"   "\   o !
            1          ]     o !__./
             \ _  _     \.___./    "~\
              X \/  \            ___./
             ( \ ___.    _..--~~"   ~`-.
              ` Z,--    /               \
                \__.   (   /       ______)
                  \    1  /-----~~" /
                   Y    \          /
                   |     "x______.^
                   |            \
                   j             Y
           --------------------------     Homer Simpson spying at the wall.
          |^^^^^^|
          |      |
          |      |
          | (o)(o)
          @      _)
           | ,___|
           |   /
           /___\
          /     \
   -------------------------      Bart Simpson spying at the wall.
        _
       ( |
       | |
       | |
       | |
   --m--oo--m--         Marge Simpson spying at the wall.
        |\|\|\
        | oo |          Bart spying at the wall.
   --M---------M--
       ..
   --m--O--m--          Maggie spying at the wall.
       ___
      (   )
      (   )
      (   )             Marge Simpson spying at the wall.
       o o
   --m-----m--
======================================================================
[HEROES]
   ____________         Invisible Man spying at the wall.
          ~~~~~
         / S /
        /   /
   ___m_oo_m___         Super Man spying at the wall.
   __m__(((..)__m__     "Monica" spying at the wall.
        _\|/_
   __m__(. .)__m__      "Cebolinha" spying at the wall.
   MMM     MMM
   \  \  /   /
    \  \/   /
     \     /
      \   /
       o o
   __m__V__m__          Batman spying at the wall.
               . -- .
              (      )
             ( (/oo\) )
              ( \''/ )                               WW
               ( \/ )      wwwwww                   /__\
              (      )   w"ww  ww"w                | oo |   _WWWWW_
             (        ) W   o""o   W    (o)(o)    (|_()_|) /  o o  \
       oo   (          )W  ______  W  w"      "w    \__/ (|  __O__  |)
     w"()"w  (        ) "w \_\/_/ w" W  -====-  W  /|\/|\  \ \___/ /  
     "wwww"     =  =    |||||||||||| w""""""""""w |||||||||=========|  
    w"    "w    =  =    ||||||||||||W            W|||||||||=========|  
 ----------------------------------------------------------------------
  Sesame Street spying at the wall.
.           .                   _-xXXXXx_      "Watch and you'll see...
 x.        x                   /XXXXXXXXX\      Someday I'll be...       
 |X\_   _/X|               __--XX| o  o|XX|     Part of your world"     o.
  |XXXXXXXX|              .XXXXXX|  /  |XXX|                        .O 
   \XXXXXX|              /XX.---_X\ ~ /XXXXX|                        oo    
    `XXXX|    ==__----____-      \/  xXXXXXX.                         . O
      \XXX|       ----_____-.       xXXXXXX/                          .
        \XXXx.           _-xXX\      "xXX-                            .
          |XXXXx_   __--   \XX|_    /  /                             .   
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
The little mermaid spying at the wall
             __  _-==-=_,-.
            /--`' \_@-@.--<
            `--'\ \   <___/.
                 \ \\   " /
                  >=\\_/`<
      ____       /= |  \_|/
    _'    `\   _/=== \___/
    `___/ //\./=/~\====\
        \   // /   | ===:
         |  ._/_,__|_ ==:        __
          \/    \\ \\`--|       / \\
           |    _     \\:      /==:-\
           `.__' `-____/       |--|==:
              \    \ ===\      :==:`-'
              _>    \ ===\    /==/
             /==\   |  ===\__/--/
            <=== \  /  ====\ \\/
            _`--  \/  === \/--'
           |       \ ==== |
   ________ -`------/`--' /___  Tiger spying at the wall.
                    \___-'
                      ____                
                    /      \              
                 /  (O)  (O)  \           
                |              |          
               |    \      /    |         
                \    |\__/|    /          
                 \ \  \__/  / /        
    __0_0_0_______/ \ ____ / \_______0_0_0_____
				 Barney spying at the wall.     
                              ._ /
                      ______ / _/
                     /______\ /
                    |(0) (0) |
                   /\________/\_
                  /   _____     \
                 | /  \___/   \ |
   ____0_0_0______\ __________ /____0_0_0_________
                                Teenage mutant ninja turtle
                                spying at the wall.
             ,())))),
           ,()))))))),.                         ,---,,,_
           ()))))))//((\                       (         ))
          (\\( \))( \(/)                      (            )
          /(          \\   heh-heh >>         (            )
          //       _   \   hey Beavis,>>      (_(_((((     )
          //   \  /    \   Watch!  <<          (    , \    )
          \   (.  .)   \  /                    |   /   )   )
          (,     |    ,) / yeah. >>       <<   |\ /    (   )
           \   ^\/^   / /  that's COOL! hey,   (.(.)    S  )
           \          /   Butt-Head...you're    /_       \ )
            \ (-<>-) /       an "ASS-kee."  \  /__)   ^   \/
             \  --  /          >>heh-heh<<      /____/    |
              \ __ /                           (______    |
               |  |                                   \   |
            __-|__|-__                              __-\__|-__
           (          )                            (          )
           |_|AC//DC|_|                            |_|METALL|_|
           | |      | |                            | |      | |  
//\/\\/\//\/\//\/\\/\//\/\\/\//\/\//\/\\//\/\\/\//\/\//\/\\//\/\\/\//\/\//
>//\/\\/\//\/\//\/\//\/\\/\//\/\//\/\\//\/\\/\//\/\//\/\\//\/\\/\//\/\//\/
//\\/\//\/\\/\\/\//\//\/\///\/\\/\//\/\//\///\/\\/\//\/\//\/\//\/\\/\//\/\
//\/\\/\//\/\//\/\\//\/\\/\//\/\//\/\\//\/\\/\//\/\//\/\\////\/\\/\//\/\//
>//\/\\/\//\/\//\/\\//\/\\/\//\/\//\/\\//\/\\/\//\/\//\/\\//\/\\/\//\/\//\
//\/\\/\//\/\//\/\\//\/\\/\//\/\//\/\\//\/\\/\//\/\//\/\\//\/\\/\//\/\//\/
				  Beavis and Butt-Head spying at the wall
======================================================================
                      ____
                    o8%8888,
                  o88%8888888.
                 8'-    -:8888b
                8'         8888
               d8.-=. ,==-.:888b
               >8 `~` :`~' d8888
               88         ,88888
               88b. `-~  ':88888
               888b ~==~ .:88888
               88888o--:':::8888
               `88888| :::' 8888b
               8888^^'       8888b   LS
              d888           ,%888b.
             d88%            %%%8--'-.
            /88:.__ ,       _%-' ---  -
           i    '''::===..-'   =  --.  `
   [""""]""""[""""""]"""""["""""]"""""]""""]""""
   """[""""]"""""["""""]"""""]""""""]"""["""""]"
   """]""""[""""""]"""""["""""]"""""]""""]"""""[
   "[""""]"""""["""""]"""""]""""""]"""["""""]"""
   Mona Lisa spying at the wall.
======================================================================
[SPACE]
        oo
        ||
   ___m_OO_m___         Alien spying at the wall.
         __
   ___m_[..]_m___       Robot spying at the wall.
        OO
       /||\
      ------
   ___m_||_m___         Darth Vader spying at the wall.
       ________
       | O  O |
        \    /
         ----
          ||            E.T. spying at the wall.
          ||
   --///------\\\--
    ///        \\\
   ooo          ooo
    |o|
       |o|
   ____________         Imperial Tie fighters spying at the wall.
    |o|
       |o|
             (o)
   __________________   Imperial Tie fighters and Darth Vader ship
                        spying at the wall.
   _________@@__________     imperial AT-AT spying over the wall of the
                             Hoth rebel base (pun intended).
           _____
          / ___ \=[]_
           \\  \\
   ________//__//_______     O.K., here's the AT-AT spying at the wall.
                ||
                ||
                ||
               \||/
               -[]-
               /||\
                ||
                ||
                ==
                EE
              //EE\\
             //    \\
   -------------------------    Luke Skywalker while levitating upwards
                                to spy at the wall, holding lightsaber
                                as seen on poster.
              ___
             / o \
   ----------------------    R2-D2 spying at the wall.
              ___|(-
             / o \
   ----------------------    R2-D2 spying at the wall, using his sattelite
                             dish, too.
              __
             |**|
   ----------------------    Jawa spying at the wall.
        A /  \  o
       /    \/|>
      / \       /\
   __/___\______\ \____      Vader and Luke saberfighting and spying
                             at the wall.
              _____
             (@___@)  
   _____oooO___| |__Oooo_____ E.T. spying at the wall.
======================================================================
[THE WORLD]
   ___m_--_m___         Chinese spying at the wall.
             ooo
   __m_--_m_c| |__      Chinese spying and drinking at the wall.
        []
      ------
   ___m_oo_m___         Mexican spying at the wall.
        .
       o o              Indian Guru spying at the wall.
   --m-----m--
        .               Indian Guru spying at the wall using
   --m-----m--          his third vision only.
      (___)
       o o              Viking spying at the wall.
   --m-----m--
     ..      ooo
   __m_--_m_c| |__      Chinese spying, drinking and smoking at the wall.
      ./
        6 o
   ___M_ 0 _M___        The Chinese vomiting at the wall.
        .!`
        ',
      z
       z
        z
   ___m_--_m___         The same Chinese hangover at the wall...
       
              ***                                 
            &/***\&                               
          (((ooooo)))     
         /@'.''.''.'@\    
        ((oo((( )))oo))   
        ((?  .   . "?))   
         -"   __   "-     
          "\__  __/"      
          "   []   "      
          /# #\/# #\      
         / \  /   / \     
   ___________________________   Japanese Princess spying at the wall.  
         _________
         |        |
     ____|________|____
        //// _____)
        _|   (o)(o)
       (o        \|
         |     (..)
         |    /||||\
         | \     \\
         |  ----__\\__
                )    (
   ____________(      )_______   Gaucho spying at the wall.
                \    /
                 \__/
               ||
               \/
           ////--\\\
          /// 0 0 \\\
            \  "  /
   ______mm__\_~_/__mm______     Indian spying at the wall.
             / \
     _______/xxx\________
     \__________________/
   _____m__\_o_o_/__m_______     Little mexican boy spying
                                 at the walll. (mexican accent)
       (BBBBBBBBBBB)
       (BBB @ @ BBB)
       (BBB  U  BBB)
       (BBB ___ BBB)
   _m__(BBB_\_/_BBB)___m__       Rastafari spying at the wall.
             _____
          __|     |____
        /             \
       /_______________\
          |         |
         (      (..)|
          |         B        
          |      ___|
          |      \__----@
   _______|_________|_________  Backwoodsman surprised in the wall.
                        _\|/_
                         | |
                         | |
                         |_|
                @@@@@@@@@|-|@@@@@@@@@
               @@@@@@(         )@@@@@@
              @@@@@@@(  0   0  )@@@@@@@
             @@@@@@@@(    U    )@@@@@@@@
            @@@@@@@@@(  _____  )@@@@@@@@@
           @@@@@@@@@@(  \___/  )@@@@@@@@@@
                      )       (
                       )     (
                        )   (
                        )   (
                       )     (
      _____m__________)_______(_________m______
                           Yet another indian spying at the wall.
======================================================================
[SPORTS]
     o=====o=====o\    0 __
     |\  :.  .   . \._/_\ _>_
   __|_`o=====o=====o__ /|____   Playing snooker and spying at the wall.
        |           |  | |
        |           |
                                                o
         o     o  o  o  o  o  o  o  o  o  o    \/)
       _(\____/_)/_)/_)/_)/_)/_)/_)/_)/_)/_)____\_____
   ______\___/__/__/__/__/__/__/__/__/__/________\ /_______
                                                  \
                                 Rowing and spying at the wall.
                  ._ O
   ________________ //\.
                   \>> |
                    \\           Skiing and spying at the wall.
             ***
           ***  \o
          **** \ |\
         ****** <<
        *******  \
   -----------------             Surfing and spying at the wall.
                           \e/
     __o          __o       I
    `\<,         `\<,      `\\,
   _O/ O_________O/_O______O/_O_ Biking and spying at the wall.
             o
   /|   o         o
   \|=--            o
      ##
                      \\
                   /   \O
                  O_/   T
                  T    /|
                  |\  | |
   _______________|_|________ Playing basketball and spying at the wall.
            |\
            |-\
            |--\
            |---\
            |----\
            |-----\
           /|------\
          / |-------\
         /| |--------\
        /-| |---------\
       /--| |----------\
      /---| |-----------\
     /----| |------------\
    /_____| |-----O-------\
   /        |____/ \____|___-\
   \------------------------| |
    \                       |
   ----------------------------- Sailing and spying at the wall.
           \
            \  O,
     (_______\/ )_______/
   -----------\--------------    Rowing and spying at the wall.
               \
      o   \ o /  _ o         __|    \ /     |__        o _  \ o /   o    
     /|\    |     /\   __\o    \o    |    o/    o/__   /\     |    /|\   
     / \   / \   | \  /)  |    ( \  /o\  / )    |  (\  / |   / \   / \
    -------------------------------------------------------------------
        Aerobics and spying at the wall. 
 
        o
           o
       o O
      `\/Y\/~
    ____/_\____         Playing with balls and spying at the wall.
         o
      /\O/                          O
     0  \\            |           0-#
   _____//____________|____________/_\______
                                 Playing tennis and spying at the wall.
              _ o
               /\  \__/
   ___________|_\__/ /o          Jumping and spying at the wall.
                      \ /
                       |
                      /o\
              %%%%%%%%%%%%%%
               %%%%%%%%%%%% _\         ~~ ~
             %%%%%%%%%%%%%    >  ,___
                 %%%%%%%'  _`   / _==.
                      __/ /____/ |          /_
          ~  ~~      /  _________|       <^)(((=(
                   ~ \  .) )                "
           _\         \   (                    ~      ~~
        )=)))(^>       \  ,%*%%%%%%*%%-._
            "           \%%%%*%%%*%%%%/  )
              ~~ ~~      %*%%%%%*%%%*/  /|
                   ~      `*%%*%%%%* | / |  ~~ ~
______________________________       |/ \|
                                     /  /|
                                    /|  \|  
                                    |/   '
                         		 Speed jumping at the wall
                              
         _
       _| |_
      |_   _|
        | |
        | |
       /   \
      |     |
      |     |
   -------------                 RIP and spying at the wall.
                                 (after the jump...)
                       0 _
    ii                / \ `O
   __iiii______________ /|____   Bowling and spying at the wall.
     iii               | \
      i
                        o
     _ 0  .-----\-----.  ,_0 _
   o' / \ |\     \     \    \ `o
   __|\___|_`-----\-----`__ /|____   Playing table tennis
     / |     |          |  | \       and spying at the wall.
             |          |
       ,   yeah        ,
       \    /         /
        \0          0/
         |\/      \/|
         |          |
        / \        / \
   ____/___\______/___\_________     Working out and spying at the wall.
      ,    yeah       uhoo
       \    /          /
        \0          O   ..
         |\_      \/|\_o[]
         |          |
        / \        / \
   ____/___\______/___\__________    Working out, drinking beer
                                     and spying at the wall.
            no          ops
         0  /            /
       \/|\__
         |           _     _
        / \           \   /
   ____/___\___________\ /_______    Working out, falling down and
                        |            spying at the wall.
                        |  o[],
                       /O\  @@
                      /   \  @
   _______________________________________________________
                     o  o
                     o o o                          Scuba diver spying
                   o                                under the wall.
                  o    ______          ______
                  _ *o(_||___)________/___
                O(_)(       o  ______/    \
                 ^  `/------o-'            \
               *____/
        \o
         |\
        <<
   ------O------   Monobiking and spying at the wall.
                !
      O)   O)   `\ O                                   O
    /`\|  //`-<    \\                .               /`\\>
   _>>____`Z_______/<__________________________________/<__
                   Playing baseball and spying at the wall.
          __==~^~~===-_
        _==~        ~~##==_
        ===  |   | , /  ####
        \ \  |   |' /  / ####
         \ \ |   | /  /  /  /
          ` \|   |/  /  / ,'
          \  |   |  / ,','
           \ |   | /,' ,'
            \`   ;/' ,'
             \`  / ,'
              |o| '
              _X'
             ||
   ---------''-----------------  Para spying at the wall.
            O       o /
           {"#v  --v#"'
           /'>    <`\
   -----------------------  Fighting and spying at the wall.
              ____|
           o  \%/ |~~\
     o//              |
     8                |
    / >               |
   ~ ~             ~~~~~~
   ------------------------  Playing basketball and spying at the wall.
          /~\o /-()  -- -  -
          \_/ \\/ )  -- - --       Biking funny and spying at the wall.
                |/_\  -- - --   -
                 \_/ .  . .  ........
   -------------------------------------
======================================================================
[GAMES]
         ____
        /    \
       |   * *|
   ____|/\/\/\|_____________        Inky spying at PacMan at the wall.
          ____
         /    \
   -----|   ==<------------         Pacman is eating the wall !!!!
         \____/
         ____
        /    \
       |o o   |
   ____|/\/\/\|_____________        PacMan ate a pill and Inky
                                    is running from the wall.
   HI323109      PL1: 234513
   o  o  o  o  o  o  o  o  o
    *  *  *  *     *  *  *
   #  #  #  0  #     #  #  #
         |  .
            .
   __________/\_____________        Space Invaders spying at the wall.
      ______
      |    O
      |
      |     _ _ _ _ N _   A _   _ _ E   _ A _ _
   ___|________________________________________
                                    Playing Hangman and spying
                                    at the wall. (Hint: it's a ASCII joke...)
              @@
            @@@@
            @@
                ##  <>
              ######<>
            [][][][]<>
    <><><><>[][][][]<>
   ------------------------         Tetris spying at the wall.
       |     |     |
       |    000    |
       |   11111   |
   __m_|__2222222__|_m_______       Towers of Hanoi spying at the wall.
======================================================================
[WEIRD OBJECTS]
         __  /
        | _O - -
        ||   \
   _____||_____         Periscope spying at the wall.
   (( --|-- ))
      --|--
      --|--
        |
   ___m_|_m___          Ham Radio spying at the wall.
======================================================================
[BIZARRE]
        ____
       | -- |
       ||  ||
       | -- |
       |. --|
       |____|
       ______           Macintosh spying at the wall.
      |::::::|
       ------  _
   -\---------|"|-
     \         -
        .    .
         \  /
          \/
        +----+
        |   .|
        | OO.|
   ___m_|____|_m___     TV spying at the wall.
                 ~
               ~
           /\ __
          /  \||
         /    \|
        / ___  \
        | | |  |
        | |.|  |
   ___m_|_|_|__|_m___   House spying at the wall.
       o
      -|-
   ___/_\_____          Childish drawing spying at the wall.
                          __/\__
                          \    /
                    __/\__/    \__/\__
                    \                /
                    /_              _\
                      \            /
        __/\__      __/            \__      __/\__
        \    /      \                /      \    /
   _/\__/    \__/\__/                \__/\__/    \__/\__
   -----------------------------------------------------
                        Fractal spying at the wall.
         /|\
        |||||
        |||||
    /\  |||||
   |||| |||||
   |||| |||||  /\
   |||| ||||| ||||
    \|`-'|||| ||||
     \__ |||| ||||
        ||||`-'|||
        |||| ___/
        |||||
        |||||
   -----------------    Cactus spying at the wall.
          /\
         /  \
         \   \__
          \   \o\
   ________\___\o\___   Sinking and spying at the wall.
          )       \   /      (
         /|\      )\_/(     /|\
        / | \    (/\|/\)   / | \
   ____/__|__o____\`|'/___o__|__\______  Lucifer spying at the wall.
            '^`    \|/   '^`
                    V
             \/
             /\
            /  \
           /    \
   _______/__/\__\__________      Indian house spying at the wall.
           \/  \/  \/
           /\  /\  /\
   _______/__\/__\/__\___         Indian Village spying at the wall.
            .     .  .      +     .      .          .
       .       .      .     #       .           .
          .      .         ###            .      .      .
        .      .   "#:. .:##"##:. .:#"  .      .
            .      . "####"###"####"  .
         .     "#:.    .:#"###"#:.    .:#"  .        .       .
    .             "#########"#########"        .        .
          .    "#:.  "####"###"####"  .:#"   .       .
                "#######""##"##""#######"                  .
                  ."##"#####"#####"##"           .      .
      .   "#:. ...  .:##"###"###"##:.  ... .:#"     .
      .   "#:. ...  .:##"###"###"##:.  ... .:#"     .
      .    .     "#####""#######""#####"    .      .
              .     "      000      "    .     .
         .         .   .   000     .        .       .
   -----------------------00000-----------------------------------
                                Christmas tree spying at the wall.
        CGATTAGACACAGAGATATGGGCAA
        |||||||||||||||||||||||||
   _____GCTAATCTGTGTCTCTATACCCGTT______  DNA sequence
                                         spying at the wall.
        ________
       |        |
       |        |
   ____|        |__________________      "Baloon" spying at the wall.
       `----. .-'
            |/
              __________
             |          |
             |______(*)_|
             /\__----__/\
            /_/()||||()\_\
            |_\ o||||o /_|
   _________|----JeeP----|________________________
            |_|        |_|
                                Jeep getting thru and spying
                                at the wall.
                __|__
         --o--o--(_)--o--o--
   ------------------------------ Flying and spying over the wall.
             __o
           _ \<;_.  Bike on the wall.
   ______ (_)/ (_)
    ___________
   | _________ |  -------
   ||         || |       |
   ||         || |       |        
   ||         || |       |
   ||_________|| |       |
   m_ \     /____|_______|___m__   Computer spying at the wall.
   --------8<----m-oo--m---------  Cut here in order to spy at the wall.
            +-------------+
           /|            /|
          / |           / |
         /  |          /  |
        /   |         /   |
       +----|--------+    |
       |    |        |    |
       |    |        |    |
       |    +--------|----+
       |   /         |   /
       |  /          |  /
       | /           | /
       |/            |/
       +-------------+
   ----------------------------     Cube spying at the wall.
          +-------------+
         /|\           /|\
        / | +---------/-|-+
       /  |/|        /  |/|
      /   / |       /   / |
     +---/|-|------+   /| |
     |\ / | |      |\ / | |
     | +--|-|------|-+  | |
     | |  +-|------|-|--+ |
     | | / \|      | | / \|
     | |/   +------|-|/---+
     | /   /       | /   /
     |/|  /        |/|  /
     +-|-/---------+ | /
      \|/           \|/
       +-------------+
   ----------------------------     Hypercube spying at (?!?) the wall.
            ________
           (_______(|
           |       ||
           |  How  ||
           |   to  ||
           |  Spy  ||
   --------|_______|-------         Book spying at the wall.
                                        _               _
                                       //|             //|
                                      // |            // |
                                     //  //////////////  |
                                    //  //////////////   |
               _        _          //  /////////////-|   |
              //|      //|        //  ////////.---'-;|   |
             // //////// |       //  ////////;;;;;-;;|   |
            // ////////  |      //  ////////;;;;;-;;;|   |
           // ////////   |     //  ////////.---'/|;;;|   |
          // ////////    |_   //  ////////////// |;;;|   |
         // ////////     //| //  //////////////  |;;;|   |
        // ////////     // //|~~~'''----'''~~|   |;;;|   |
       // ////////     // ///|               |   |;;;|   |
      // ////////     // ////|===============|   |;;;|   |
     // ////////     // /////| Ye Olde Magic |   |;;;|   |
     |~~~~~~~~|     // //////|     Book      |   |;;;|   |
    /|        |    // ///////|===============|   |;;;|   |
   //|  The   |   // ////////|               |   |;;;|   |
  ///|Complete|  // /////////|               |   |;;;|   |
 ////| Works  | // //////////|               |   |;;;|   |
|~~~||  of    |// ///////////|               |   |;;     |
|THE||        ||~'---..---'~||  Calculus IV  |   |;      |
|SPY||  The   ||  Barney's  ||    For the    |   |'      |
|LAW|| Spies  ||  Guide to  ||     Spies     |   |       |
|   ||        ||    the     ||               |           |
|   ||        ||            ||               |           |
|   ||        ||  *  *****  ||               |          /|
|   ||        ||  *  *   *  ||               |         //|
|   ||        ||  ****   *  ||               |        // |
|   ||        ||            ||               |       //  |
|   ||        ||  ********  ||               |      //   |
|   ||        ||     *   *  ||               |     //    |
|   ||        ||     *****  ||               |    //     |
|   ||        ||            ||               |   //     /
|   ||        ||  ****** *  ||               |  //     /
|   ||        ||            ||               | //     /
|   ||        ||  ********  ||               |//     /
|   ||        ||  *   *  *  ||               |/     /
|   ||        ||  *   *  *  ||               |     /
|   ||Yohannes||            ||---------------|    /
|...||Barnabas||  *  *****  ||  5th Edition  |   /
|...||   &    ||  *  *   *  ||---------------|  /
|   ||  Howe  ||  ****   *  ||               | /
|___||________||____________||_______________|/_______
          The spy library spying at the wall.
                  ___
             ,,==/   \
            //  /-----\
           //
           ||
          /  \
          | O|
   _______|__|_____________         Stand lamp spying at the wall.
                  ___
             ,,==/ _ \
            //  | (_) |
           //    \___/
           ||
          /  \
          | O|
   _______|__|____________          Stand lamp spying frankly at the wall.
              /|
             / |
            /  |
           /   |
          /  O |
   ______/_____|___________         Set square spying at the wall.
           /~\/\
          /  O |
   ______/_____|___________         The same set square spying at the wall.
                                    (Caught and broken by stone)
======================================================================
[RESTING AND SPYING]
    .o___/\
   /\```````/\
  ------------------  Sleeping and spying at the wall
        /\      /\
   ____:^)-----<__L____ Resting and spying at the wall.
        \/      \
                 \_
        /\     /\
   ____:^?----<__L____  Resting, smoking a pipe and spying at the wall.
        \/     \
                \_
        /\      /\
   ___*<:^)----<__L____ Resting, wearing a Santa Claus hat and spying
        \/      \       at the wall.
                 \_
        /\      /\
   _OOOO:^)----<__L____ Marge Simpson resting and spying at the wall.
        \/      \
                 \_
        /\      /\
   ____@:^)----<__L____ Resting, wearing a turban and spying at the wall.
        \/      \
                 \_
        /\     /\
   ___=:^)----<__L____  Punk Rocker resting and spying at the wall.
        \/     \
                \_
        /\     /\
   __C=:^)----<__L____  Chef resting and spying at the wall.
        \/     \
                \_
        w
         \
          \     /\
   ____:^D-----<__L____ Resting, saying "Hi" and spying the wall.
        \/      \
                 \_
           ooo
          c|_|  /\
   ____:^D-----<__L____ Resting, drinking and spying at the wall.
        \/      \
                 \_
         ,_
         O \    /\
   ____:^O-----<__L____ Resting, eating an apple and spying at the wall.
        \/      \
                 \_
         _____
         \ \  \
          P_\__\  /\
   ____:^D-------<__L____  Resting, reading the newspaper and spying
        \/        \        at the wall.
                   \_
         _____
         \ \  \
          P_\__q   /\
   ____B^|-----/--<__L____ Resting, reading the newspaper (with glasses)
             \/    \       and spying at the wall.
                    \_
       \|/
      -( )-
       /|\
        /\      /\
   ____B^)-----<__L____    Resting (under the sun) and spying at the wall.
        \/      \
                 \_
              w
             /
            /     /\
   ____B:^( -----/==L==/____ Resting (but the sun has gone for a while)
        \/                   and spying at the wall.
       w
        \
         \      /\
   ____B^D-----<__L____      Superstar resting and spying at the wall.
         /      \
        /        \_
       m
           ?
            \
            /      /\
   ____ >:^) -----/==L==/___ Captain Hook resting, saying "Hi" and
          \/                 spying at the wall.
         /\     /\
   ____:^)-----<__L____      Rapunzel resting and spying at the wall.
       ()\/     \
       ()        \_
       ()
       ()
       ()
        X
       *-w-
          \
          /     /\
   ____:^)-----<__L____      Rapunzel resting, dreaming about the
       () \     \            Enchanted prince and spying at the wall.
       ()  \     \_
       ()   m
       ()
       ()
        X
        /\      /\
   ____%^|-----<__L____      Tired of lying at the wall.
        \/      \
                 \_
======================================================================
[EFTIWALL FONT]
   This   is a Figlet  font created  by  Michel  Eftimakis. To use it,
   the Figlet  freeware is needed.  To find  Figlet and the 'eftiwall'
   font (or any other Figlet font), ftp to:
   ftp.nicoh.com/pub/figlet  -- Official Figlet site !!!
    __________      ___           ___
   |Look  Here|    '/_\          /\#/\
   |__________|    (o o)        /(o o)\
   -----||-----ooO--(_)--Ooo-ooO--(_)--Ooo
     ( ( (                   ))
      ) ) )                 ((
      ( ( (           ___o___)
     '. ___ .'        |     |====O
    '  (> <) '        |_____|
  --ooO-(_)-Ooo--------------------
        ( ( (          |"|    ,------.
      '. ___ .'       _|_|_   | Hi ! |
     '  (> <) '       (o o)   _)-----'
   -ooO--(_)--Ooo-ooO--(_)--Ooo-------
   ,---------------------------.                  _
   | (c) Michel Eftimakis 1995 |   ...          _|_|_        __MMM__
   `--------------------------(_  (o -)         (o o)         (o o)
   ---------------------------ooO--(_)--Ooo-ooO--(_)--Ooo-ooO--(_)--Ooo-
======================================================================
[OTHERS]
   __m____m___          Dwarf spying at the wall.
        oo
   --m--->--m--         Alain Prost spying at the wall.
   ___m_O_m___          Cyclops spying at the wall.
        __
        ||
   ___m_oo_m___         Man using a hat spying at the wall.
        oo
   ___m_oo_m___         Four-eyes spying at the wall.
   ___m_@^@_m___        man with glasses spying at the wall.
   _m_oo_m_m_oo_m_      Twins spying at the wall.
   _m_oo_mm_oo_m_       Siamese Twins spying at the wall.
        ++
        /\
   ___m_oo_m___         Priest spying at the wall.
       ____
       |  |
      ------
   --m--oo--m--         Yet another man with a hat spying at the wall.
   --m--xx--m--         Dead cartoon spying at the wall.
    -----------
   |           |
   |    (O)    |        Spying through a hole on the wall.
   |           |
   ____________________________________     Spying through the wall II.
   |__|__|__|__|__|__|__|__|__|__|__|
   __|__|__|__|__|__|..|__|__|__|__|
   _|__|__|__|__|__|__|__|__|__|__|__|
   |__|__|__|__|__|__|__|__|__|__|__|__|_
 |____|____|____|____|____|____|____|____|____|____|____|____|____
 ____|____|____|____|____|____|____|____|____|____|____|____|____|
 __|____|____|____|____|___|_         ____|____|____|____|____|__
 |____|____|____|____|___|    (\.-./)  _|____|____|____|___|___|_ 
____|____|____|____|____|_  = (^ Y ^) =  _|____|____|____|____|__
|____|____|____|____|____|___ /`---`\ __|____|____|____|____|____|
 __|____|____|____|____|____|_U___|_U|____|____|____|____|____|_  
 |____|____|____|____|____|____|____|____|____|____|____|____|____
__|____|____|____|____|____|____|____|____|____|____|____|____|_
                                                The same magnified
       o o\             Soldier spying at the wall.
   --m--------
   __m_oo_?__           Cap. Hook spying at the wall.
   __m_oo__             One-handed spying at the wall.
   _______oo______      Wall spying at the wall.
   _______________
   ____________         spying at the wall (Upside down).
     w  oo  w
   __m__oo__m__         Spying the grass from the wall.
   WWwWwwwWwwWW
            ..
   XxXxXxmxXxXmXxXxXxXxXxXxX    Spying at the Sobibor wall.
   -------------------------
    ___           m_oo_m__      Spying at the (remains of) Berlin wall.
    _|__         |__|__|__|
   |__|_         _|__|__|_
   _|__|_         _|__|__|
   |__|__|       _|__|__|_
      |
      E
      |                 Spying at the right side off the wall.
   ( o|
      >
   ( o|
      |
      E
      |
   \ \ \ \ \ \
   \ \ \ \ \ \ \
   \ \ \ \ \ \ \
   __m__oo__m__         Spying in the rain at the wall.
   \ \ \ \ \ \ \ \ \
   \ \ \ \ \ \ \ \ \
   \ \ ___________
   \ \/     |     \
   \ \      |
            J
   ___m__oo__W_______   Spying with an umbrella in the rain at the wall.
   __m_O_O_m___         Happy to spy at the wall.
       `-'
  ====\
        \,
         O
   ___m_o_o_m___        Sir Isaac Newton spying at the wall.
         ,
    >----O---->
   ___m_o_o_m___        William Tell's son spying at the wall.
   -----------------    Baby spying and falling off the wall.
              _
          \   /
        :^O--<
          /   \_
            _ _
          w(. .)w
         /   O   \
   -----------------    Baby spying and falling off the wall.
              _         (but mom is watching...)
          \   /
        :^0--<
          /   \_
       ___
      |---|
      |   /O
   --m-----m--          LOG spying over wall.
         W
   ___m_o_o_m___        King spying at the wall.
         +
   ___m_o_o_m___        Queen spying at the wall.
   _________0-n_________________     Key forgotten for someone that was
                                     spying at this wall.
            _
   ______m_/ \_m___________     Spying someone spying at the wall.
          \\ //                 (backwards...)
            |
           / \
          /   \
         _____
        |  _  |
        |_/ \_|
   __m__|_____|___m__          Telebras logo spying at the wall.
            ____
           /    \
           (.  .)
           | \/ |
           \----/
           |\__/|
   _.---.__|____|__.---.____Giant spying at the wall (there are some people
    UUUU            UUUU       that don't like to be anonymous...)
             _____________
   _________/____________/|_______  Chip spying at the wall.
            |||||||||||||
              _______
   __________( 12:08 )__________    Digital watch spying at the wall.
   -----------------------          Cave crawling clan spying
        /                           under the wall.
    ___O\
   />  \
           #####
          ( O O )
   ------M-------M---------
                                    Person hanging on for dear life
                                    while spying at a suspended wall.
   ------------------------
        _//     \\_
       (_/       \_)
        /\___/\
        | o o |
       __\_^_/__
      (__/   \__)
       _|  .  |_
   ___(__\___/__)____          Teddy bear spying at the wall.
   xWvoKfV0zI+m0tf
   i45BmbosrLiv1mz
   GYrjUruv39gzitL
   SIRfEJAgAS6PTfO
   ________________            PGP Signature spying at the wall.
       O          \/
      #|_        (_|
   ___###\.______| |___        Watching TV and spying at the wall.
           /O^O\
   --------------------        Using a binocular for spying at the wall.
           ___     ___
          //  \/0\/  \\
         //\__/-^-\__/\\
        //             \\
   --------------------------      The same, seen through a binocular.
   ()()()()()()()()()()()()()
   --------------------------      No spying, barbed wire coils on top.
   __________p^o_________      One-armed person using a binocular for
                               spying at the wall, being far away.
        _   _
       {~._.~}
        ( Y )
       ()~*~()
   ____(_)_(_)____             Little teddy bear on the wall.
          ____________
         /   |    |   \
        /    |  0 |    \
       /     | /T\|     \
      /      ------      \
     /          \ \       \
   --------------------------         Swinging, & spying at the wall.
     O       O       O      O
     <       <       <      <
     /\      /\      /\     /\
   -----------------------------      Spying at the Abbey Road wall.
      CRVL 0,11
      CRVL 0,12
      CHPR L6, 0
   ___ARMZ 0,13___       MEPA code spying at the wall.
      MOV AX, 0451H
      MOV DX, AX
   ___CALL PRINT___      80x86 ASSEMBLY code spying at the wall.
   ___(member '(A B C D 1 (A B)) A)___
                         LISP code spying at the wall.
                         (but it returns `t')
              ' `
   ---------m-O-O-m---------   man with glasses spying at the wall.
                               (but the glasses are falling down...)
               \ \
                @^@
     ___,___,____,____                 ___,___,____,____
    /               /                 /               /
   /__,___,___,___,/__               /__,___,___,___,/__
   |______m_o_o_m__|____          ___|______________|
   ____|____|____|____|_\        /___|____|____|____|
   __|____|____|____|____\       |_|____|____|____|_
   ____|____|____|____|___\      /___|____|____|____|
   __|____|____|____|____|_|  __/__|____|____|____|__
   ____|____|____|____|____|\/__|____|____|____|____|
   __|____|____|____|____|____|____|____|____|____|____|
                                        Spying upon the Berlin wall.
       \0/
        0
       / \
   ___________    Man (Discreetly) spying on the wall.
    | | | | |
      o____      o____      o____      o____      o____      o____
      |_3D_|     |_3D_|     |_3D_|     |_3D_|     |_3D_|     |_3D_|
      |          |          |          |          |          |
      (__)     (_|)     (__)|    (__)  |  (__)    |(__)     (|_)
      (oo)     (oo)     (oo)|    (oo)  |  (oo)    |(oo)     (oo)
     m|\/ m   m \/ m   m \/ m   m \/ m | m \/ m   m \/ m   m \/ m
   /""""""/""""""/""""""/""""""/""""""/""""""/""""""/""""""/""""""/|
   H""""""H""""""H""""""H""""""H""""""H""""""H""""""H""""""H""""""H|
   H""""""H""""""H""""""H""""""H""""""H""""""H""""""H""""""H""""""H|
   H""""""H""""""H""""""H""""""H""""""H""""""H""""""H""""""H""""""H/ LS
    """""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""
    3D cows spying at the wall.
         o    |~~~|
        /\_  _|   |
        \__`[_    |     Playing the piano and spying at the wall.
        ][ \,/|___|
   --------------------
       //O\\
        /|\
        (o-"=           Playing guitar and spying at the wall.
        / \
  ----------------------  
                _________________________________
               |'  Please,                      '|
               |   don't shoot the piano player, |
               |   he is doing his best.         |
               |_________________________________|   
     o     _______________________________
    /\_  _|          |                   |
   _\__`[____________|___________________|
   ] [ \,      ][               ][
  -------------------------------------------
  Playing the grand piano with a banner and spying at the wall.
 
                         |\                |\
       ____|\__|_________|\\___|___________|___|____________|\_|__
       ____|/__|________@__\|__|____O______|___|___@________|__|__
       ___/|___|___|________|__|___|______@____|__|____@____|__|__
       __|_/_\_|___|_______@___|___|___________|__|___|____@___|__
   __m____\|/__|___|___________|___|___________|__|___|________|__m__
           /      O                                   |
                                Music spying at the wall.
                                       _
                                      /   )
                                     @| ?\
       ._-_.    _____________________@| ?\\
      +|\G/|+  | ____________________@| ?\\\
      +|\./|+  || O  o o o  =|=  |  =@| ?\\\\
      +|\./|+  || O  o o o   |  =|=  | -- ====
       `|H|'   ||______________________||\ \\\
        |a|    |________________________| \ \\\
        |H|    ||MM88MM<<<<<|
                                   @
                                  ##
        Y Y           Y Y        ###
       |O O|         |O O|      (0.0)
   -----\"/-----------\"/-------#####-------------+
                                 ###              |
                                                  |
                Hoo!Hoo!Hoo!...
                Santa Claus and his reindeers spying at the wall.
          _________
           ___|___
          | \ | \ |
          | \ | \ |
   _______|___|___|__________  Kanji for rain spying at the wall.
   _________8______________    Snowman spying at the wall.
                               (too small?)
           O==========
   ______m_W_m_____________    Pinoccio spying at the wall.
                               (He's saying "I'm not spying.")
======================================================================
** END OF DICTIONARY