R1b1c4 aka M153


John McEwan

3rd June 2006 (typo revision 23 October 2006)



M153 is a SNP that defines subclade R1b1c4 in the ISOGG 2006 Y chromosome tree.


Technical details

The SNP was described by Underhill et al (2000) as


M153 T->A 427 ttactgataatgccatattgttttg ttctcagacaccaatggtcct


Using May 2006 Golden Path and in silico PCR the following sequence was obtained from Yq11.222. Attempts to retrieve it from DbSNP were unsuccessful and it most likely does not have a dbSNP accession. The mutation was manually annotated below. The T allele is ancestral.















It was first described by Underhill et al (2000) where it was found in 7 people all Basques.  Bosch et al. (2001) described a further derived individual, Flores et al. (2004) 6 individuals, Paracchini et al. (2003) 5 “Latino” individuals, Vallone and Butler (2004) 1 “Caucasian” and Alonso et al. (2005) 18 individuals. In total 38 people have been identified as derived for this SNP to date. Further details are shown in a summary page of R1b SNP papers.  Alonso et al. (2005) also tested 5 STR markers and Bosch et al. (2001) 8 STR markers. Unfortunately Alonso et al. (2005) does not provide the haplogroup for individual STR results, but Bosch et al (2001) did, and the modal values they reported are shown below. No difference from the R1b modal was observed.


In summary M153 positive or derived individuals have been described in at least 6 studies. It has only been reported in the Iberian Peninsula or in people whose origin was almost certainly descendants from that region. Its STR modal is the same as R1b.


 Table 1. Modal values of R1b and R1b1c4 (M153) in FTDNA order and convention

































Alonso S, Flores C, Cabrera V, Alonso A, Martin P, Albarran C, Izagirre N, de la Rua C, Garcia O. 2005. The place of the Basques in the European Y-chromosome diversity landscape. Eur J Hum Genet. 2005 13:1293-302.

Bosch, E., Calafell, F., Comas, D., Oefner, P.J., Underhill, P.A. and Bertranpetit, J. 2001. High-resolution analysis of human Y-chromosome variation shows a sharp discontinuity and limited gene flow between Northwestern Africa and the Iberian Peninsula. Am. J. Hum. Genet. 68:1019-1029.

Flores, C., N. Maca-Meyer, A.M. González, P.J. Oefner, P. Shen, J.A. Pérez, A. Rojas, J.M. Larruga and P.A. Underhill. 2004. Reduced genetic structure of the Iberian Peninsula revealed by Y-chromosome analysis: implications for population demography. Eur. J. Hum. Genet. 12:855-863

Paracchini S, Pearce CL, Kolonel LN, Altshuler D, Henderson BE, Tyler-Smith C. 2003.   A Y chromosomal influence on prostate cancer risk: the multi-ethnic cohort study. J Med Genet. 40:815-9.

Underhill PA, Shen P, Lin AA, Jin L, Passarino G, Yang WH, Kauffman E, Bonne-Tamir B, Bertranpetit J, Francalacci P, Ibrahim M, Jenkins T, Kidd JR, Mehdi SQ, Seielstad MT, Wells RS, Piazza A, Davis RW, Feldman MW, Cavalli-Sforza LL, Oefner PJ. 2000. Y chromosome sequence variation and the history of human populations. Nat. Genet. 26:358-361

Vallone PM, Butler JM. 2004 Y-SNP typing of U.S. African American and Caucasian samples using allele-specific hybridization and primer extension. J Forensic Sci. 49:723-32.