Palindromati - Table 2 Expanded. ctcgtgccgaattcggcacgag. Fernando Castro-Chavez. Oct.-2005.

Table 2. Transcripts with traces of an EcoRI related linker ctcgtgccgaattcggcacgag * and their supposed locations according to Genbank plus realted references.

#	Accession / Organism	Gene/Protein (Gene symbol) [notes for sides of linker (L or R)]	Linker and its Amino Acids in Genbank	*Corresponding References According to Genbank; closest related match*
1	U58090 Homo sapiens	Cullin gene family member, Hs-cul-4A	aattcggcacgagctcgtgccgct NSARARAA	Cell 85, 829-839. 1996.
2	U28831 Homo sapiens	Protein immuno-reactive with anti-PTH polyclonal antibodies	gcacgagctcgtgccgat ARARAD	Proc. Assoc. Am. Physicians 107, 296-305. 1995.
3	BC041619 Homo sapiens	Protein KIAA0404, for IMAGE:5923662 [R: hypoth. prot. MGC16044]	ccctcgtgccgaattcggcacgag PSCRIRHE	Proc. Natl. Acad. Sci. U.S.A. 99, 16899-16903. 2002.
4	AF176705 Homo sapiens	F-box protein FBX10 (PINX1) [R: vector]	cctcgtgccgaattc PRAEF	Curr. Biol. 9, 1180-2. 1999.
5	X85792 Homo sapiens	Vpr binding protein 1	tcgtgccgaattcggcacgag SCRIRHE	Benichou et al. [Unpublished]; J Biol Chem. 277, 45091-8. 2002
6	AF151109 Homo sapiens	Putative BRCA1-interacting protein (BRIP1)	ggcacgagctcgtgccgc GTSSCR	Wang et al. BRCA1-interacting protein. [Unpublished]; Oncogene 19, 6152-8. 2000.
7	AF146697 Homo sapiens	FOXP1	aagaattcggcacgagct KNSARA	Cancer Res. 61, 8820-8829. 2001.
8	NM_002342 Homo sapiens	Gene and 3' UTR for TNFR superfamily, member 3 (LTBR)	gctcgtgccgaattc	Genomics 16, 214-218. 1993. [Curated by NCBI]
9	X93499 Homo sapiens	RAB7 protein, GTP-binding [L: Dystroglycan 1. C: Rab7. R: Envelope glycoprotein]	ccccgaattcgggg & gcccgaattcgggc	Biochem. Biophys. Res. Commun. 229, 887-890. 1996.
10	X82200 Homo sapiens	Gene and mRNA for interferon-induced Staf50	gaattcggcacgagctc	J. Biol. Chem. 270, 14891-14898. 1995.
11	U31384 Homo sapiens	mRNA for G protein gamma-11 subunit	ggcacgagctcgtgccg	J. Biol. Chem. 270, 21765-21771. 1995.
12	AF379619 Homo sapiens	Intron near AB13, precursor mRNA	gaattcggcacgagct	van Roy and Staes. New human gene family. [Unpublished].
13	AY245868 Homo sapiens	CDS for Aldehyde oxidase-like protein (AOX2) pseudogene	aagaattcggcacgagca LNSARA	Wright RM. Human aldehyde oxidase. [Unpublished].
14	AF339764 Homo sapiens	mRNA from Fetal liver spleen IMAGE:108721	gaattcggcacgagcggcacgagct	Genomics 79, 635-656. 2002.
15	U43527 Homo sapiens	5'UTR for Malignant melanoma metastasis-suppressor (KiSS-1)	(ctct)¹⁵cctcgtgccgaattcggcacgag	J. Natl. Cancer Inst. 88, 1731-1737. 1996; Genomics 54, 145-148. 1998.
16	AY029161 Homo sapiens	3'UTR for PinX1 [L: LPTL. R: PHPT1]	ctcgtgccgaattcggcac	Cell 107, 347-359. 2001.
17	NR_001557 Homo sapiens	Gene Aldehyde oxidase 2 (AOX2) on Chromosome 2	gaattcggcacgagc	J. Biol. Chem. 276, 46347-46363. 2001; Genome Res. 6, 807-828. 1996.
18	AF039656 Homo sapiens	Gene for neuronal tissue-enriched acidic protein (NAP-22)	gaattcggcacgagctc	Mol. Cells 8, 471-477. 1998.
19	Z28355 Homo sapiens	cDNA, Atrium library Human heart	(ctct)¹⁶cgtgccgaattcggc	C. R. Acad. Sci. III, Sci. Vie. 318, 263-272. 1995.

20	AB030505 Mus musculus	3'UTR for androgen-regulated homolog (Arsdr) & Mum1, and 5'UTR for Retinol dehydrogenase 11 (Rdh11)	ctcgtgccgaattcggcacgag	Goto and Eddy. [Direct Submission]; Diabetes 52, 2666-74. 2003.
21	NM_178759 and BC032879 Mus musculus	T-cell immunoglobulin and mucin domain containing 4 (Timd4) [L: Doc4. R: Hypot. Threo-rich region/Ig ctg prot]	acctcgtgccgaattcggcacgag TSCRIRHE	Eur. J. Immunol. 34, 494-03. 2004; Proc. Natl. Acad. Sci. U.S.A. 99, 16899-03. 2002.
22	AJ237586 Mus musculus	Hypothetical protein in thymocytes	cactcgtgccgaattcggcacgag HSCRIRHE	Immunogenetics. 50, 255-70. 1999.
23	NM_026928 Mus musculus	1810014F10Rik, fucose binding	acctcgtgccgaattcggcacgaggcctcgtgccgaattcggcacgag TSCRIRHEASCRIRHE	J. Biol. Chem. 278, 28173-28180. 2003; Biotechnol. Bioeng. 86, 136-148. 2004.
24	AB094480 Mus musculus	LE51 hypothetical protein	acctcgtgccgaattcggcacgaggcctcgtgccgaattcggcacgag TSCRIRHEASCRIRHE	Biotechnol. Bioeng. 86, 136-148. 2004.
25	AF487346 Mus musculus	Dscaml1 [L: Nucleoside diphosphate kinase homologue]	ctcgtgccgaattcggcacgag TRAEFGTR	Shimohata et al. Cloning and characterization of mouse Dscaml1 [Unpublished].
26	U24160 Mus musculus	5'UTR for Dvl-2	gaattcggcacgagctcg	Mech. Dev. 58, 15-26. 1996.
27	L49502 Mus musculus	Gene, mRNA and 5'UTR for Phosphoprotein (p150TSP)	cgaattcggcacgagct	J. Biol. Chem. 271, 6952-6962. 1996.
28	AJ010792 Mus musculus	Muc5AC protein	gaattcggcacgagctgc EFGTSC	Gastroenterology 118, 70-80. 2000.
29	NM_012047 Mus musculus	5'UTR for bromodomain containing 7 (also called Brd7, Bp75, Celtix1, Ptpn13ip)	gaattcggcacgagct	J. Cell. Physiol. 185, 269-279. 2000; FEBS Lett. 459, 291-298. 1999.
30	AI607511 Mus musculus	EST similar to Acidic ribosomal phosophoprotein	ctcgtgccgaattcggcacgag	Marra et al. [Unpublished].
31	AF466768 Mus musculus	5'UTR for Monoclonal antibody BBK-1 light chain	ggcacgaggcctcgtgccgaattcggcacgagg	Lee et al. [Direct Submission].
32	AF071010 Mouse mammary tumor virus (MMTV)	Putative integrase, fusion protein, insertion of proviral MMTV into mouse SH3 domain-containing protein	ctcgtgctgaattcggcacgagga LVLNSARG	Popken-Harris et al. MMTV in Mice. [Unpublished]; Virus Genes 23, 35-43. 2001.
33	U35364 Rattus norvegicus	Sly1 homologue	tctcgtgccgaattcggcacgagc SRAEFGTS	Gene 169, 293-294. 1996.
34	NM_019326 Rattus norvegicus	Gene for neurogenic differentiation 2 (Neurod2)	gaattcggcacgagctc	J. Neurochem. 88, 1041-1051. 2004; Biochem. Biophys. Res. Commun. 219, 526-530. 1996.
35	D82868 Rattus norvegicus	mRNA for bHLH protein	gaattcggcacgagctc	Biochem. Biophys. Res. Commun. 219, 526-530. 1996.
36	D63834 Rattus norvegicus	5' UTR for Monocarboxylate transporter MCT1	gaattcggcacgagct	Biochem. Biophys. Res. Commun. 217, 370-377. 1995.
37	NM_053484 & AJ131902 Rattus norvegicus	3' UTR for Growth arrest specific 7 (Gas7)	cgaattcggcacgagc	Chao CC [Unpublished]; J. Neurosci. Res. 74, 248-54. 2003.
38	NM_031626 & U14533 Rattus norvegicus	5' UTR & 3' UTR for Nuclear receptor subfamily 1, group H, 2 (Nr1h2)	gaattcggcacgagc & agctcgtgccgaattc	Proc. Natl. Acad. Sci. U.S.A. 91, 10809-10813. 1994, and 92, 2096-2100. 1995.
39	U07609 Rattus norvegicus	5' UTR & 3' UTR for Na+-dependent inorganic phosphate cotransporter	gaattcggcacgagc & agctcgtgccgaattc	Proc. Natl. Acad. Sci. U.S.A. 91, 5607-5611. 1994.
40	NM_173145 Rattus norvegicus	5' UTR & 3' UTR for large homolog-associated protein 4 (Dlgap4)	gaattcggcacgagc & ctcgtgccgaattc	J. Biol. Chem. 272, 11943-11951. 1997.
41	NM_134335 Rattus norvegicus	5' UTR & 3' UTR for Myosin IXA (Myo9a)	gaattcggcacgag & ctcgtgccgaattcg	Baehler M. Protein Myr 7. [Unpublished].
42	NM_053770 Rattus norvegicus	5' UTR & 3' UTR for Arg/Abl-interacting protein ArgBP2	gaattcggcacgag & cgtgccgaattc	J. Biol. Chem. 274, 30914-30918. 1999.
43	X57710 & D00853 Oryctolagus cuniculus	MRNA for alpha-1-antiproteinase F	cggcacgagctcgtgcc	J. Biochem. 109, 158-162. 1991.
44	AY141975 Papio hamadryas	5'UTR for Epididymal protease inhibitor 2 (Eppin)	gcacgagctcgtgccg	Sivashanmugam et al. Baboon. [Unpublished].
45	AF147784 Canis familiaris	Retinal-specific clusterin-like preprotein (Clul1) [L:Kiaa1191]	actcgtgccgaattcggcacgagc TRAEFGTS	Gene. 243, 151-160. 2000.
46	NM_001003025 Canis familiaris	Gene and mRNA for ID3 protein	gaattcggcacgagct	Exp. Cell Res. 279, 62-70. 2002.
47	AB099113 Bos taurus	5'UTR for mitochondrial RNA, similar to 12S rRNA	ctcgtgccgaattcggcacgag	Mol. Reprod. Dev. 65, 9-18. 2003.
48	U83919 Bos taurus	mRNA for Neurofilament L subunit	gaattcggcacgagctc	Hill et al. [Unpublished]; J Mol. Neurosci. 20, 223-32. 2003.
49	L81157 Equus caballus	Immunoglobulin mu (IgM), VDJC region	gaattcggcacgagctca EFGTSS	Immunogenetics 45, 386-393. 1997.
50	L81159 Equus caballus	Immunoglobulin mu (IgM), VDJC region	aggaattcggcacgagag RNSARE	Immunogenetics 45, 386-393. 1997.
51	AF506976 Equus caballus	3' UTR for Capping protein	ttcggcacgagctcgtgccg	Takafuji et al. [Unpublished]; Am J Vet Res. 63, 551-8. 2002.
52	L27860 Equus caballus	T-cell receptor DNA, V region	tcgaattcggcacgagca SNSARA	Immunogenetics 40, 135-144. 1994.
53	NM_214016 & AF384216 Sus scrofa	Gene for CECR1 protein	gaattcggcacgagctc	Gene 280, 27-36. 2001.
54	L43124 Sus scrofa	5'UTR for vascular cell adhesion molecule (VCAM)	gaattcggcacgagct	Biochem. Biophys. Res. Commun. 201, 805-812. 1994; Transplantation 60, 1299-1306. 1995.
55	NM_214078 & AF163766 Sus scrofa	3'UTR for P-selectin (SELP)	gctcgtgccgaattc	J. Immunol. 164, 3309-3315. 2000.
56	AF049746 Monodelphis domestica	Gene for Ig lambda light chain	ggcacgagctcgtgccg	J. Immunol. 161, 6724-6732. 1998.
57	AF010497 Monodelphis domestica	5'UTR & 3'UTR for MHC class II beta chain precursor (Modo-DAB1)	aattcggcacgagct & agctcgtgccgaattc	Immunogenetics 49, 461-463. 1999.
58	AJ291982 Platichthys flesus	5'UTR for 40S Ribosomal protein S15a (Rps15a)	gaattcggcacgagc	Aquat. Toxicol. 65, 141-157. 2003.
59	NM_204873 & AJ012287 Gallus gallus	3'UTR for Alpha tectorin (LOC395686)	agctcgtgccgaattc	Hear. Res. 130 (1-2), 62-74. 1999.
60	NM_204412 & U01339 Gallus gallus	5'UTR & 3'UTR for Achaete-scute complex-like 1 (ASCL1)	gaattcggcacgagc & ctcgtgccgaattc	Mol. Cell. Neurosci. 25, 374-382. 2004; Development 120, 769-783. 1994.
61	AY775183 & AY727528 Pimephales promelas	3' UTR for Estrogen receptor alpha	ctcgtgccgaattcg	Filby & Tyler. Fathead Minnow. [Unpublished]; Environ. Sci. Technol.. 38, 6314-21. 2004.
62	AF179870 Rana pipiens	Guanylate cyclase type 2 (Gc2)	ctcgctcgtgccgaattcggcacgaga LARAEFGTR	Mol. Cell. Biochem. 254, 9-19. 2003.
63	AB178055 Rana japonica	5'UTR for Gonadotropin alpha-subunit (GTH alpha)	aattcggcacgaggcctcgtgccgaattcggcacgagg	Nakano et al. Gonadotropin subunit in Frog Pituitary Gland. [Unpublished].
64	AB072909 Xenopus laevis	5'UTR for Claudin4L2	ctcgtgccgaattcggcacga	Gene Expr. Patterns 2, 23-26. 2002.
65	AJ243595 Xenopus laevis	5'UTR for homeodomain transcription factor XPitx2B	ccgaattcggcacgagctcg	Mech. Dev. 90, 41-51. 2000.
66	AF115498 Xenopus laevis	Smad1 antagonistic effector (Sane)[R:Man1]	ctcgtgccgaattcggcacgaggt LVPNSARG	J. Biol. Chem. 278, 428-437. 2003.
67	AF069737 Xenopus laevis	Gene for notchless (Nle), a Notch activity modulator	gaattcggcacgagctc	EMBO J. 17, 7351-7360. 1998.
68	AF419156 Xenopus laevis	Map kinase-interacting kinase	cgaattcggcacgag RIRHE	Curr. Biol. 12, 105-114. 2002.
69	AF419153 Xenopus laevis	Mitotic phosphoprotein 67 [L: Map kinase-interacting kinase]	ttcgaattcggcacgagg FEFGTR	Curr. Biol. 12, 105-114. 2002.
70	AF419149 Xenopus laevis	Mitotic phosphoprotein 22	ttcgaattcggcacgagt FEFGTS	Curr. Biol. 12, 105-114. 2002.
71	AJ249625 Paracentrotus lividus	Gene for for Chaperonin (Hsp60)	gaattcggcacgagctc	Cell Stress Chaperones 5, 87-89. 2000.
72	AY027936 Salmo salar	Hyperosmotic protein 21 (P21) [R: ring-box 1, Rbx1]	ctcgtgccgaattcggcacgagcg LVPNSARA	Am. J. Physiol. Regul. Integr. Comp. Physiol. 282, R1643-53. 2002.
73	AY190729 Pagrus major	Ribosomal protein L10a	gcacgaggctcgtgccgaattcggcacgag ARGSCRIRHE	Aquaculture 240, 115-130. 2004.
74	NM_199765 Danio rerio	PHD finger protein 6 (phf6).	tctcgtgccgaattcggg SRAEFG	Proc. Natl. Acad. Sci. U.S.A. 99, 16899-16903. 2002.
75	BC044163 Danio rerio	Similar to RIKEN cDNA 4931428F02	tctcgtgccgaattcggg SRAEFG	Proc. Natl. Acad. Sci. U.S.A. 99, 16899-16903. 2002.
76	AJ431209 Carassius auratus	5'UTR [& CDS] for Proopiomelanocortin (Pomc)	gaattcggcacgagc [& cctcggcacgagctc PRHEL, base changes]	Regul. Pept. 115, 101-113. 2003.
77	AF013800 Salvelinus alpinus	5'UTR for Metallothionein A (MT A)	gaattcggcacgagct	Mar. Environ. Res. 46 (1-5), 551-554. 1998.
78	AY713401 Crassostrea gigas	Calmodulin, calcium-dependent protein kinase	cctcgtgccgaattcggcacgagg PRAEFGTR	Huvet et al. ESTs. [Unpubl.]; Gene 343, 211-20, 2004.
79	AY026258 Biomphalaria glabrata	Thioredoxin peroxidase BgTPx	aattcggcacgagca NSARA	Cousin et al. [Unpubl.]; Mol Biochem Parasitol. 126, 181-91. 2003.
80	AY069220 Drosophila melanogaster	Gutfeeling (Guf, GH26763), Longest ORF [R: Ornithine decarboxylase antizyme]	gctcgtgccgaattcggcacgaga ARAEFGTR	Stapleton et al. [Direct Submission ] Genome Biol. 3, RESEARCH0080. 2002; Genome Res. 12, 1294-300. 2002.
81	U48394 Drosophila melanogaster	Gene for ribosomal protein S5 homolog (M(1)15D)	gaattcggcacgagct	Genetics 144, 215-228. 1996.
82	AF242203 Drosophila melanogaster	5'UTR for Pins protein (Pins)	gaattcggcacgagc	Curr. Biol. 10, 353-362. 2000.
83	AF005852 Drosophila yakuba	Gene for Anon1G5	cgaattcggcacgagct	Proc. Natl. Acad. Sci. U.S.A. 94, 9746-9750. 1997.
84	AY295775 Depressaria pastinacella	Cytochrome P450 (CYP9A7)	atcgaattcggcacgagg IEFGTR	Insect Mol. Biol. 13, 603-613. 2004.
85	XM_312915 Anopheles gambiae	ENSANGP00000014770 (ENSANGG00000012281)	tacgtgccgaattcggcc YVPNSA [base changes]	The Anopheles Genome Sequencing Consortium
86	AB180424 & AB180425 Plutella xylostella	5'UTR for Ribosomal proteins L21 & S28	ggcacgaggcctcgtgccgaattcggcacgagg	Eum et al. EST Analysis of moth. [Direct Submission]
87	AF014463 Phoneutria nigriventer	Gene & mRNA for Neurotoxic protein (Pn2-5A)	ctcgtgccgaattcgg	Toxicon. 36,1843-50. 1998.
88	AF026060 Chironomus tentans	Telomeric region	gaattcggcacgagctc	Kamnert et al. [Direct Submission]; Insect Mol. Biol. 11, 167-74. 2002; J. Mol. Evol. 46, 562-70. 1998.
89	Y11879 Arenicola marina	Trypsin-like protease	cgtgccgaattcggcacgagt RAEFGTS	Eberhardt and Peterson. [Direct Submission].
90	Y08489 Schistosoma mansoni	Serine-rich protein	gaattcggcacgagcttt EFGTSF	Schuessler P. Molecules in the male-female interaction of S.mansoni. [Unpublished].
91	AY223273 Schistosoma japonicum	hypothetical protein UBX domain	cctcgtgccgaattcggcacgagg PRAEFGTR	Nat. Genet. 35, 139-147. 2003.
92	AB104619 Polyplastron multivesiculatum	Cellulase (celA)	gcacgagctcgtgccgaattcggcacgagg ARARAEFGTR	Takenaka et al. Fibrolytic enzyme cDNA from rumen ciliates. [Unpublished].
93	AY029595 Schizophyllum commune	Putative beta-glucan synthesis-associated protein (bgs1)	gcacgagctcgtgccgaattcggcacgag ARARAEFGTS	Guettler et al. Bgs1 gene. [Unpublished]; Fungal Genet Biol. 39, 191-8. 2003.
94	AJ005572 Plasmodium falciparum	Hypothetical protein [R: karyopherin beta (KP1)]	acgagctcgtgccgaattcggcacgag TSSCRIRHE	Shams-Eldin et al. [Unpublished]
95	S79293 & D16136 Dirofilaria immitis	Filarial common antigen [R: Cloning Vector, i.e., pUC & Phage f1 deriv.]	gctcgtgccgaattc ARAEF	Chin. Med. J. 108, 466-468. 1995.
96	AB002777 Entamoeba histolytica	5'UTR for ribosomal protein S29	ctcgtgccgaattcggcacgag	Biochem. Biophys. Res. Commun. 236, 611-615. 1997.
97	AB002794 and AB002739 Entamoeba histolytica	Small subunit rRNA	ctcgtgccgaattcggcacgag	Biochem. Biophys. Res. Commun. 236, 611-615. 1997.
98	AB002728 Entamoeba histolytica	Elongation factor 1 alpha (Ef1A)	cctcgtgccgaattcggcacgagg PRAEFGTR	Biochem. Biophys. Res. Commun. 236, 611-15. 1997.
99	AB002741 Entamoeba histolytica	Amoebapore C homologue	ctcgtgccgaattcggcacgag SCRIRHE	Biochem. Biophys. Res. Commun. 236, 611-15. 1997.
100	AB002731 Entamoeba histolytica	Histone H1	ctcgtgccgaattcggctcgaggc LVPNSARG	Biochem. Biophys. Res. Commun. 236, 611-15. 1997.
101	AJ496453 Laminaria digitata	Mannuronan C-5-epimerase (Epi)	gaattcggcacgagc EFGTS	Plant Physiol. 133, 726-735. 2003.
102	AF273835 Caenorhabditis elegans	Nuclear receptor NHR-91	ctcgtgccgaattcggcacgag SCRIRHE	Robinson-Rechavi et al. HNF4 in nematodes. [Unpublished]
103	X68492 , L03711 & L04287 Caenorhabditis elegans	Gene and mRNA for Rac1 homologue, a small ras-related protein	gaattcggcacgagcttgtgc	J. Biol. Chem. 268, 320-324. 1993.
104	AB047581 Hydra vulgaris	Gene, mRNA & 5' UTR for homologue CnDMC1	gagctcgtgccgaatt	Mochizuki & Fujisawa. [Direct Submission].
105	L22612 Hydra vulgaris	5' UTR & 3' UTR for tyrosine kinase receptor	gaattcggcacgagct & gctcgtgccgaattc	J. Biol. Chem. 275, 10323-10330. 2000.
106	AF306544 Hydra vulgaris	3' UTR for Serum response factor (SRF)	gctcgtgccgaattc	Dev. Biol. 236, 304-315 2001.
107	AJ250043 Anisakis simplex	Hypothetical protein	cggcacgagctcgtgccgaattcggcacgagga RHELVPNSARG	Arrieta et al. Anisakis simplex for a 12 kD protein. [Unpublished]
108	AY057457 Stizostedion vitreum	Major histocompatibility class I receptor	cctcgtgccgaattcggcacgagg PRAEFGTR	Immunogenetics. 53, 760-769. 2001.
109	Y15794 Theileria annulata	Spm1 protein	actcgtgccgaattcggcacgagg TRAEFGTR	Mol. Biochem. Parasitol. 100, 135-140. 1999.
110	AF332963 Polytomella sp.	5'UTR for Ferrochelatase	cctcgtgccgaattcggcacgaggcctcgtgccgaattcggcacgagg	Atteia et al. [Unpublished].
111	AJ416378 Polytomella sp.	5'UTR for Cyc	ggcacgaggcctcgtgccgaattcggcacgaggga	Atteia A. [Unpublished].
112	AY093683 Suaeda maritima	5'UTR for Mitogen-activated protein kinase kinase	ggcacgaggcctcgtgccgaattcggcacgaggga	Yin et al. [Unpublished].
113	AF043384 Pleuronectes americanus	Beta actin (ACT1)	cgagctcgtgccgaattc ELVPNS	J. Appl. Ichthyol. 15, 80-86. 1999; Mar Biotechnol (NY). 1, 458-0464. 1999.
114	AY206000 Malva pusilla	Glutathione S-transferase F1	aggaattcggcacgagca RNSARA	Goodwin et al. [Unpublished].
115	AF499715 Thellungiella halophila	5'UTR for Lipid transfer protein 4-like protein	aattcggcacgaggcctcgtgccgaattcggcacgagg	Plant Sci. 166, 609-616. 2004.
116	AF279454 Lycopersicon esculentum	Sesquiterpene synthase 2 (Sstle2)	ctcgtgccgaattcggcacgagct LVPNSARA	Plant Cell. 12, 2283-94. 2000.
117	AF332957 Lycopersicon esculentum	Fructose-1,6-bisphosphate aldolase	aattcggcacgagctc NSARAQ	Zurek and Rayle. Auxin Regulation. [Unpublished]; Plant Physiol. 104, 505-513. 1994.
118	AY157614 Ficus carica	5'UTR for Chitinase	ggcacgaggcctcgtgccgaattcggcacgagg	Plant Cell Physiol. 44, 412-414. 2003.
119	AY089962 Solanum tuberosum	Cysteine proteinase inhib. Prec. P7G8, Kunitz-type	tcgtgccgaattcggcacgagtt VPNSARV	Mol. Genet. Genomics 269, 526-534. 2003.
120	AY098939 Solanum tuberosum	Amino-cyclopropane-1-carboxylate oxidase (Aco) [ESTs in both sides]	gctcgtgccgaattcggcacgagc ARAEFGTS	J. Exp. Bot. 53, 2455-7. 2002.
121	X93160 Spinacia oleracea	5' UTR & 3' UTR for Ribosomal protein L4	aattcggcacgagctc & agctcgtgccgaattc	J. Biol. Chem. 273, 3980-3985. 1998.
122	AY324804 Nicotiana tabacum	mRNA-binding protein (csp41), nuclear gene for chloroplast product	cactcgtgccgaattcggcacgag HSCRIRHE	Plant J. 36, 842-852. 2003; Nucleic Acids Res. 31, 4317-4325. 2003.
123	AF242734 Capsicum annuum	Putative proteinase inhibitor II	cccgtgccgaattcggcacgaa PVPNSARK	Plant Sci. 161, 727-737. 2001.
124	AF467542 Triticum aestivum	Gene for putative aldehyde dehydrogenase Wis1	gaattcggcacgagctc	Plant Physiol. 129 (1), 169-180. 2002.
125	M95818 & M95819 Triticum aestivum	5'UTR for initiation factor isozyme 4F p28 subunit	gaattcggcacgagctc	J. Biol. Chem. 267, 23232-23236. 1992.
126	AY387686 Triticum aestivum	5'UTR for harpin binding protein 1 (HrBP1-1)	gaattcggcacgagct	Song et al. [Unpublished].
127	BT009402 Triticum aestivum	mRNA for clone wlm96.pk046.j8:fis	ctcgtgccgaattcggcacgagctcgtgccgaattcggcacgagg	Tingey et al. [Direct Submission].
128	NM_188717 Oryza sativa	Hypothetical protein	ggcgagctcgtgccgaattag GELVPN	The NCBI Genome Assembly Consortium [Submitted: 01-JUL-2004]
129	AF001501 Oryza sativa	MIRCH38 chitinase	ggcacgagctcgtgccgaattcggcacgag GTSSCRIRHE	Yun et al. Rice chitinase. [Unpublished]; Mol. Cells. 17, 10-6. 2004.
130	Y12594 Oryza sativa	Fd-GOGAT, 2 hours anaerobic coleoptiles	gaattcggcacgagctca EFGTSS	Mattana et al. [Unpublished, Submitted 1997]
131	AF290415 Zea mays	Crs1, splicing nuclear gene for chloroplast	attcggcacgagcga IRHER	RNA 7, 1227-1238. 2001.
132	AF126054 & AY110620 Zea mays	mRNA, 5'UTR for Rop3 small GTP binding protein & CL1205_2	gaattcggcacgagct	Biochem. Biophys. Res. Commun. 272, 783-788. 2000; Plant Physiol. 133, 1791-808. 2003; Hainey et al.
133	BT016274 & BT016336 Zea mays	mRNA from Contigs [i.e., L: Starch branching enzyme II. R: Polyubiquitin]	cctcgtgccgaattcggcacgaggcctcgtgccgaa-tcggcacgagg	Genome Res. 14(10A): 1932-7. 2004.
134	Y10252 Lotus corniculatus var. japonicus	5'UTR for Pantoate-beta-alanine ligase (PanC)	gaattcggcacgagctc	Biochem. J. 341 (Pt 3), 669-678. 1999.
135	AJ271664 Cicer arietinum	Hypothetical protein, ORF, putative metallophosphatase (ppd4)	ctcgtgccgaattcggcacgagt RAEFGTS	Dopico et al. cDNA in chickpea epicotyls. [Unpublished]; Plant Mol Biol. 35, 433-42. 1997.
136	AJ271659 Cicer arietinum	Serine carboxipeptidase	gagcggcacgagctcgtgccgac ERHELVPT	Dopico et al. Serine carboxipeptidase in chickpea epicotyls. [Unpublished].
137	X88864 Medicago sativa	5'UTR for for cyclin protein (CycMs4)	gaattcggcacgagctc	Plant Cell 7, 1847-1857. 1995.
138	U14956 Vicia faba	5'UTR for Ferredoxin NADP+ reductase precursor (fnr)	gaattcggcacgagct	Lax and Cary. [Unpublished].
139	AY220737 Hordeum vulgare	lipoxygenase 1 protein (LOXA)	gctcgtgccgaattcggcacgagg ARAEFGTR	Mol. Plant Microbe Interact. 16, 893-902. 2003.
140	AF034387 Arabidopsis thaliana	AFT protein	gctcgtgccgaattcggcacgagc ARAEFGTS	Plant Physiol. 117, 1526-1526. 1998.
141	M90510 Arabidopsis thaliana	mRNA, 5'UTR for thaumatin-like	ggcacgagctcgtgcaattcggccgaattcggcacgag	Plant Cell 4, 645-656. 1992.
142	AF001136 Pinus radiata	5'UTR & CDS for Zinc finger protein (PrCO)	ggcacgagctcgtgccgaattcggcacgagcg & gcctcgtgccgaattcggcacgagctc ASCRIRHEL	Mouradov et al. [Direct Submission]; Plant Physiol. 117, 55-62. 1998.
143	U31309 Pinus taeda	Chitinase homolog LP 6 (9^th CDS)	ctcgtgccgaattcggca LVPNSA	Plant Mol Biol. 31, 693-9. 1996.
144	AY098893 Plastid Citrus hybrid cultivar	Plastidic ATP/ADP transporter	gaattcggcacgagctta EFGTSL	Planta 217, 11-20. 2003.
145	AF195867 Vitis vinifera	Alcohol dehydrogenase 7 (Adh7) [R: ADH6 and ADH2]	actcgtgccgaattcggcacgagctcgtgccgaattcggcacgag TRAEFGTSCRIRHE	Plant Physiol. 122, 619. 2000.
146	NM_214643 & AY187547 Strongylocentrotus purpuratus	5'UTR for heat shock protein Gp96	gccgaattcggcacgag	Dev. Comp. Immunol. 27, 449-464. 2003; J. Immunol. 156, 593-602. 1996.
147	U22507 Heliocidaris tuberculata	5'UTR for cytoplasmic actin type III (htcyIII)	attcggcacgagctcg	Mol. Biol. Evol. 14, 654-665. 1997.
148	AF015712 Dictyostelium discoideum	Kinesin-related protein K2	atccgaattcggcacgag IRIRHE	de Hostos et al. [Direct Submission]; J. Biol. Chem. 273, 793-9. 1998.
149	AJ006788 Coprinus cinereus	RedA	gaattcggcacgagctca EFGTSS	Brander KA [Unpublished].
150	U44431 Trametes versicolor	5'UTR for laccase IV (lccIV)	ggcacgagctcgtgccg	Gene 196, 113-119 1997.
Related Sequences Included for Comparison (Predicted, Genomic or Prokaryotic)
A	NM_173552 & BC037293 Homo sapiens	Predicted Hypothetical protein MGC33365	ttcggcacgagctggtgccgc FGTSWCR	Nat. Genet. 36, 40-45. 2004; Proc. Natl. Acad. Sci. U.S.A. 99, 16899-16903. 2002.
B	XM_147036 Mus musculus	Predicted RIKEN cDNA 1190002N15	ttcggcacgagctggtgccgt FGTSWCR	Model Refseq, Gnomon gene prediction plus EST evidence
C	XM_236493 Rattus norvegicus	Predicted Similar to Ab2-095 (Loc315891)	ttcggcacgagctggtgccgc FGTSWCR	Model Refseq, Gnomon gene prediction plus EST evidence
D	AC103936 Mus musculus	Chromosome 9	ttcggcacgagctggtgccg	Birren et al. [Direct Submission]; Nature 420, 520-62. 2002; Nat. Genet. 22, 388-93. 1999.
E	AC117379 Homo sapiens	3 BAC RP11-392C7 (Roswell Park CIHBAC Library), complete sequence	cggcaccagctcgtgccgaa	Muzny et al. [Direct Submission].
F	AL929103 & CR318657 Danio rerio	Complete Sequence	gctcgtgccgaattc & ctcgtgccgaattc	Almeida J. [Direct Submission]; Barker G. [Direct Submission].
G	AE008692 Zymomonas mobilis	Complete Genome	tgccgaattcggcac (plus at least 3 more smaller, to 12 b, instances)	Nat Biotechnol. 2004 Dec 12; [Epub ahead of print].
H	AE017172 & AE017178 Porphyromonas gingivalis	2 Sections of the Complete Genome	ccgaattcggcacgag (plus at least 4 more smaller, to 12 b, instances)	J. Bacteriol. 185, 5591-5601. 2003.
I	CP000010 Burkholderia mallei	Chromosomes, complete sequences	acgagctcgtgccga (plus at least 50/Ch, smaller, to 12 b, instances)	Proc. Natl. Acad. Sci. U.S.A. 101, 14247-14251. 2004. (er).
J	BX571965 & BX571966 Burkholderia pseudomallei	Chromosomes 1 & 2, complete sequence	ttcggcacgagctcg (plus at least 30/Ch, smaller, to 12 b, instances)	Proc. Natl. Acad. Sci. U.S.A. 101, 14240-14245. 2004.
K	AE016994 Chlamydophila caviae	Sections of the Complete Genome	cggcacgagctcgtg & ttcggcacgagct	Nucleic Acids Res. 31, 2134-2147. 2003.
L	AY307892 Uncultured Actinobacterium	rRNA of Actinomycete	cacgagctcgtgccg	Piza & Manfio. Actinomycete diversity. [Unpublished].
M	STRSTRH Streptococcus pneumoniae	3' UTR for Beta-N-acetylhexosaminidase (strH)	agctcgtgccgaattc	J. Biol. Chem. 270, 8805-8814. 1995.
N	BX572599 Rhodopseudomonas palustris	Segment of the Complete Genome	gtgccgaattcg , gccgaattcggca , cgtgccgaattcggc	Nat. Biotechnol. 22, 55-61. 2004.
O	AE011864 Xanthomonas axonopodis	Section 242 of 469 of the complete genome	Acgagctcgtgccga	Nature 417, 459-463. 2002.
P	XM_323355 & XM_323891 Neurospora crassa	Genome of N. crassa strain OR74A	cgagctcgtgccgaa & cggcacaagctcgtgccga	Nature 422, 859-868. 2003.

* The last example-sequences (A-P), from bacteria, genomes and predicted sequences are included for comparison purposes. Note: The actual palindromes within the genes may be longer than the ones presented here.

Additional Evidence:

Zipped Word document with examples taken from the Affymetrix Microarrays.

Zipped Excel file with examples taken from the Genbank database.

Notes:

The Original Article in PDF is at the International Society for Complexity, Information and Design (ISCID).

Original Article in HTM.

Tasters of the Word (YouTube), videos recientes: "Astronomía y Nacimiento de Jesucristo: Once de Septiembre Año Tres A.C.", "Estudio sobre Sanidades" (en 20 episodios), "Jesus Christ, Son or God?":http://www.youtube.com/1fertra

Tasters of the Word (the blog, with: "Astronomy and the Birth of Jesus Christ"):http://fertra1.blogspot.com