R1b1c3 aka M126
John McEwan
23 October 2006
Background
M126 is a SNP that
defines subclade R1b1c3
in the ISOGG 2006 Y
chromosome tree.
Technical details
The SNP was described by Underhill et al (2001) as
M126 delAATA 277 gccaccctcttatgcctct tcaggagttatgtgaggaccc
Using May 2006 Golden Path and in silico PCR the following sequence was obtained from Yq11.222. The M126 mutation itself was
manually annotated (yellow below). The AATA allele is ancestral.
This SNP is currently listed in dbSNP as rs2032615 at location ChrY:20389651-20389654. It is
reported as SMCY-M125/2 and was derived in 1 of 54 individuals scanned.
>chrY:20389375+20389741 367bp GCCACCCTCTTATGCCTCT TCAGGAGTTATGTGAGGACCCGCCACCCTCTTATGCCTCTggcctttacaaagacagctggtaagaggctg
cccagctcatctgaagtacaggataagattgtctgacttggagataccat
tttccacttagcagccatgtaatctttcatattcattttttctaagtggc
acttttctcagatgtaaaatggggataatgagtttattcatctttgagtt
gctcccaagcagaagtcaacttgagactataaacttgtgctcactgcagt
gcttgaaaccgagtttgtacttaata[aata/-]gctgcatacatctttttcta
tacatgtcagatgcttaattgtgtttcccgaagatgttgccaagccGGGT
CCTCACATAACTCCTGA
Occurrence
It was first described by Underhill et al (2000) where it was reported
in 1 “European” after genotyping 1062 individuals from a variety of countries.
The SNP was originally detected scanning a global population of 53
individuals. To date even though it has
been tested in several studies and many thousands of people no further derived
individuals have been found.
Summary
This SNP appears to be a private SNP.
References
Underhill PA, Shen P, Lin AA, Jin L, Passarino
G, Yang WH, Kauffman E, Bonne-Tamir B, Bertranpetit J, Francalacci P, Ibrahim M, Jenkins T, Kidd JR, Mehdi
SQ, Seielstad MT, Wells RS, Piazza A, Davis RW,
Feldman MW, Cavalli-Sforza LL, Oefner
PJ. 2000. Y chromosome sequence variation and the history of human populations.
Nat. Genet. 26:358-361
Underhill, P.A., Passarino, G., Lin, A.A., Shen,
P., Mirazon Lahr, M., Foley, R.A., Oefner, P.J. and Cavalli-Sforza,
L.L. 2001. The phylogeography of Y
chromosome binary haplotypes and the origins of
modern human populations. Ann. Hum. Genet. 65:
43-62.