R1b1c4 aka
M153
John McEwan
3rd June 2006 (typo revision 23 October 2006)
Background
M153 is a SNP that
defines subclade R1b1c4 in the ISOGG
2006 Y chromosome tree.
Technical details
The SNP was described by Underhill et al (2000) as
M153 T->A 427 ttactgataatgccatattgttttg
ttctcagacaccaatggtcct
Using May 2006 Golden
Path and in silico PCR the
following sequence was obtained from Yq11.222.
Attempts to retrieve it from DbSNP
were unsuccessful and it most likely does not have a dbSNP accession. The
mutation was manually annotated below. The T allele is ancestral.
>chrY:20165716-20166174
459bp TTACTGATAATGCCATATTGTTTTG TTCTCAGACACCAATGGTCCT
TTACTGATAATGCCATATTGTTTTGgcttaatatcaggctaagtaaccac
agtattctgatttaaaaaaaaacatactagagagcaagtttattgacaaa
tctttaggaacttcaggtacagcatatgatttctgaactatgtgtgtaaa
taaggttttgtttattcaaatttaacacagggtagtctgtgtatgccttc
cgatttgatagctctaataaaacactttaatagtaccatatcaaataaat
tttatcatcatcgattttcttcttaatatgaaataacacatatttgtgat
ttttctaagagtcaaaatctcaaaaatcattttaggtataaaatataccc
cgaaagttttattttattccattttataattaatctgacttggaaagggg
aaaaaagctcaaagggtatgtgaaca[t/a]ttcattaagatAGGACCATTGGT
GTCTGAGAA
Occurrence
It was first described by Underhill et al (2000) where it was found in 7
people all Basques. Bosch et al. (2001)
described a further derived individual, Flores et al. (2004) 6 individuals,
Paracchini et al. (2003) 5 “Latino” individuals, Vallone and Butler (2004) 1
“Caucasian” and Alonso et al. (2005) 18 individuals. In total 38 people have
been identified as derived for this SNP to date. Further details are shown in a
summary page of R1b SNP papers. Alonso et al. (2005) also tested 5 STR
markers and Bosch et al. (2001) 8 STR markers. Unfortunately Alonso et al.
(2005) does not provide the haplogroup for individual STR results, but Bosch et
al (2001) did, and the modal values they reported are shown below. No
difference from the R1b modal was observed.
In summary M153 positive or derived individuals have been described in
at least 6 studies. It has only been reported in the Iberian Peninsula or in
people whose origin was almost certainly descendants from that region. Its STR
modal is the same as R1b.
Table 1. Modal values of R1b and R1b1c4 (M153) in FTDNA order and
convention
|
haplogroup |
N |
DYS393 |
DYS390 |
DYS19 |
DYS391 |
DYS388 |
DYS389i |
DYS392 |
DYS389ii |
|
R1b |
|
13 |
24 |
14 |
11 |
12 |
13 |
13 |
29 |
|
R1b1c4 |
6 |
13 |
24 |
14 |
11 |
12 |
13 |
13 |
29 |
References
Alonso S, Flores
C, Cabrera V, Alonso A, Martin P, Albarran C, Izagirre N, de la Rua C, Garcia
O. 2005. The place of the Basques in the
European Y-chromosome diversity landscape. Eur J Hum Genet. 2005 13:1293-302.
Bosch, E.,
Calafell, F., Comas, D., Oefner, P.J., Underhill, P.A. and Bertranpetit, J.
2001. High-resolution analysis of human Y-chromosome variation shows a sharp
discontinuity and limited gene flow between Northwestern Africa and the Iberian
Peninsula. Am. J. Hum. Genet. 68:1019-1029.
Flores, C., N. Maca-Meyer, A.M. González, P.J.
Oefner, P. Shen, J.A. Pérez, A. Rojas, J.M. Larruga and P.A. Underhill. 2004.
Reduced genetic structure of the Iberian Peninsula revealed by Y-chromosome
analysis: implications for population demography. Eur. J. Hum. Genet.
12:855-863
Paracchini S, Pearce CL, Kolonel LN, Altshuler D,
Henderson BE, Tyler-Smith C. 2003. A Y chromosomal
influence on prostate cancer risk: the multi-ethnic cohort study. J Med Genet.
40:815-9.
Underhill PA, Shen
P, Lin AA, Jin L, Passarino G, Yang WH, Kauffman E, Bonne-Tamir B, Bertranpetit
J, Francalacci P, Ibrahim M, Jenkins T, Kidd JR, Mehdi SQ, Seielstad MT, Wells
RS, Piazza A, Davis RW, Feldman MW, Cavalli-Sforza LL, Oefner PJ. 2000. Y
chromosome sequence variation and the history of human populations. Nat. Genet.
26:358-361
Vallone PM, Butler
JM. 2004 Y-SNP typing of U.S. African American and Caucasian samples using
allele-specific hybridization and primer extension. J Forensic Sci. 49:723-32.