R1b1c1 aka M37
John McEwan
24 October 2006
Background
M37 is a SNP that
defines subclade R1b1c1
in the ISOGG 2006 Y
chromosome tree.
Technical details
The SNP was described by Underhill et al (2001) as
M37 C->T 203 cagattggattgatttcagcctt
agcatacaaaaaaaaaaaactgc
Using May 2006 Golden
Path and in silico
PCR the following sequence was obtained from Yq11.222. Attempts to retrieve it from DbSNP suggested the primers also
amplify rs34289137 at location 20210837 of NCBI Build 36.1 (green below). Cross
checking has identified that this is M61
which defines haplogroup L. The M37 mutation itself was manually annotated (yellow below). The C
allele is ancestral.
>chrY:20210737+20211158 422bp CAGATTGGATTGATTTCAGCCTT AGCATACAAAAAAAAAAAACTGCCAGATTGGATTGATTTCAGCCTTcttctggtactttttaaaatcttatta
atcattaggaaaagaagttttattattgatgcaagccctaaacactcttt
[c/t]gactccagaggagaagctggcagctctctgtaagaaatatgctgatcttgtgagtatttatttaatggagcaaggaacacagaaaataaaatctatgtg
tg[c/t]ttgataagatttttaaatattattttgatgtaactttaaatgtaaaa
tgatattttatctcaaaattgaaaacaatctcctttctttagtacttatg
attggtgtgtgtgacttcatcttatgaaatgatgtatagaacataataat
acttttttaaatgtgaaataaatttcctaaaacttaatatgctagatcaG
CAGTTTTTTTTTTTTGTATGCT
Occurrence
It was first described by Underhill et al (2000) where it was reported
in 2 people both “Australian” after genotyping 1062 individuals from a variety
of countries. The Australians were presumably aborigine (but perhaps admixed).
The SNP was originally detected scanning a global population of 53
individuals. To date even though it has
been tested in at least 7 studies and many thousands of people no further
derived individuals have been found. Interestingly another SNP rs34289137 has
been recently found nearby consisting of a C/T mutation and has been reported
to be derived in 2 out of 44 individuals from a world wide sampling, one from
North America and another from a multi-national group.
Unresolved issues
·
I find it strange that it was found in a screen of 53
people and then in several Australians (unstated but likely “aborigines”
presumably via European admixture) and never observed again.
·
It is interesting a similar type of SNP M61 has
recently been found independently just 102 bp away in
2 out of 44 individuals from a diverse world wide sample.
Summary
It is suggested that if the original samples are still available they
are resequenced to confirm the SNP location and also
tested against the current R1b ISOGG SNPs to confirm
its position in the ISOGG tree.
References
Underhill PA, Shen P, Lin AA, Jin L, Passarino
G, Yang WH, Kauffman E, Bonne-Tamir B, Bertranpetit J, Francalacci P, Ibrahim M, Jenkins T, Kidd JR, Mehdi
SQ, Seielstad MT, Wells RS, Piazza A, Davis RW,
Feldman MW, Cavalli-Sforza LL, Oefner
PJ. 2000. Y chromosome sequence variation and the history of human populations.
Nat. Genet. 26:358-361
Underhill, P.A., Passarino, G., Lin, A.A., Shen,
P., Mirazon Lahr, M., Foley, R.A., Oefner, P.J. and Cavalli-Sforza,
L.L. 2001. The phylogeography of Y
chromosome binary haplotypes and the origins of
modern human populations. Ann. Hum. Genet. 65:
43-62.